105 resultados para Mutation de spécification
Resumo:
EDD (E3 isolated by differential display), located at chromosome 8q22.3, is the human orthologue of the Drosophila melanogaster tumour suppressor gene 'hyperplastic discs' and encodes a HECT domain E3 ubiquitin protein-ligase. To investigate the possible involvement of EDD in human cancer, several cancers from diverse tissue sites were analysed for allelic gain or loss (allelic imbalance, AI) at the EDD locus using an EDD-specific microsatellite, CEDD, and other polymorphic microsatellites mapped in the vicinity of the 8q22.3 locus. Of 143 cancers studied, 38 had AI at CEDD (42% of 90 informative cases). In 14 of these cases, discrete regions of imbalance encompassing 8q22.3 were present, while the remainder had more extensive 8q aberrations. AI of CEDD was most frequent in ovarian cancer (22/47 informative cases, 47%), particularly in the serous subtype (16/22, 73%), but was rare in benign and borderline ovarian tumours. AI was also common in breast cancer (31%), hepatocellular carcinoma (46%), squamous cell carcinoma of the tongue (50%) and metastatic melanoma (18%). AI is likely to represent amplification of the EDD gene locus rather than loss of heterozygosity, as quantitative RT-PCR and immunohistochemistry showed that EDD mRNA and protein are frequently overexpressed in breast and ovarian cancers, while among breast cancer cell lines EDD overexpression and increased gene copy number were correlated. These results demonstrate that AI at the EDD locus is common in a diversity of carcinomas and that the EDD gene is frequently overexpressed in breast and ovarian cancer, implying a potential role in cancer progression.
Resumo:
Background: Mutations in SCN1A, the gene encoding the alpha1 subunit of the sodium channel, have been found in severe myoclonic epilepsy of infancy (SMEI) and generalized epilepsy with febrile seizures plus (GEFS(+)). Mutations in SMEI include missense, nonsense, and frameshift mutations more commonly arising de novo in affected patients. This finding is difficult to reconcile with the family history of GEFS(+) in a significant proportion of patients with SMEI Infantile spasms (IS), or West syndrome, is a severe epileptic encephalopathy that is usually symptomatic. In some cases, no etiology is found and there is a family history of epilepsy. Method: The authors screened SCN1A in 24 patients with SMEI and 23 with IS. Results: Mutations were found in 8 of 24 (33%) SMEI patients, a frequency much lower than initial reports from Europe and Japan. One mutation near the carboxy terminus was identified in an IS patient. A family history of seizures was found in 17 of 24 patients with SMEI. Conclusions: The rate of SCN1A mutations in this cohort of SMEI patients suggests that other factors may be important in SMEI. Less severe mutations associated with GEFS(+) could interact with other loci to cause SMEI in cases with a family history of GEFS(+). This study extends the phenotypic heterogeneity of mutations in SCN1A to include IS.
Resumo:
The spastic (spa) and oscillator (ot) mouse have naturally occurring mutations in the inhibitory glycine receptor (GlyR) and exhibit severe motor disturbances when exposed to unexpected sensory stimuli. We examined the effects of the spa and ot mutations on GlyR- and GABA(A)R-mediated synaptic transmission in the superficial dorsal horn (SFDH), a spinal cord region where inhibition is important for nociceptive processing. Spontaneous mIPSCs were recorded from visually identified neurones in parasagittal spinal cord slices. Neurones received exclusively GABA(A)R-mediated mIPSCs, exclusively GlyR-mediated mIPSCs or both types of mIPSCs. In control mice (wild-type and spa/+) over 40 % of neurones received both types of mIPSCs, over 30 % received solely GABA(A)R-mediated mIPSCs and the remainder received solely GlyR-mediated mIPSCs. In spa/spa animals, 97 % of the neurones received exclusively GABA(A)ergic or both types of mIPSCs. In ot/ot animals, over 80 % of the neurones received exclusively GABA(A)R-mediated mIPSCs. GlyR-mediated mIPSC amplitude and charge were reduced in spa/spa and ot/ot animals. GABA,Rmediated mIPSC amplitude and charge were elevated in spa/spa but unaltered in ot/ot animals. GlyR- and GABA(A)R-mediated mIPSC decay times were similar for all genotypes, consistent with the mutations altering receptor numbers but not kinetics. These findings suggest the spastic and oscillator mutations, traditionally considered motor disturbances, also disrupt inhibition in a sensory region associated with nociceptive transmission. Furthermore, the spastic mutation results in a compensatory increase in GABA(A)ergic transmission in SFDH neurones, a form of inhibitory synaptic plasticity absent in the oscillator mouse.
Resumo:
The 19-amino acid conopeptide (rho-TIA) was shown previously to antagonize noncompetitively alpha(1B)-adrenergic receptors (ARs). Because this is the first peptide ligand for these receptors, we compared its interactions with the three recombinant human alpha(1)-AR subtypes (alpha(1A), alpha(1B), and alpha(1D)). Radioligand binding assays showed that rho-TIA was 10-fold selective for human alpha(1B)- over alpha(1A)- and alpha(1D)-ARs. As observed with hamster alpha(1B)-ARs, rho-TIA decreased the number of binding sites (B-max) for human alpha(1B)-ARs without changing affinity (K-D), and this inhibition was unaffected by the length of incubation but was reversed by washing. However, rho-TIA had opposite effects at human alpha(1A)-ARs and alpha(1D)-ARs, decreasing KD without changing Bmax, suggesting it acts competitively at these subtypes. rho-TIA reduced maximal NE-stimulated [H-3] inositol phosphate formation in HEK293 cells expressing human alpha(1B)-ARs but competitively inhibited responses in cells expressing alpha(1A)- or alpha(1D)-ARs. Truncation mutants showed that the amino-terminal domains of alpha(1B)- or alpha(1D)-ARs are not involved in interaction with rho-TIA. Alanine-scanning mutagenesis of rho-TIA showed F18A had an increased selectivity for alpha(1B)-ARs, and F18N also increased subtype selectivity. I8A had a slightly reduced potency at alpha(1B)-ARs and was found to be a competitive, rather than noncompetitive, inhibitor in both radioligand and functional assays. Thus rho-TIA noncompetitively inhibits alpha(1B)-ARs but competitively inhibits the other two subtypes, and this selectivity can be increased by mutation. These differential interactions do not involve the receptor amino termini and are not because of the charged nature of the peptide, and isoleucine 8 is critical for its noncompetitive inhibition at alpha(1B)-ARs.
Resumo:
Study objective: To investigate the effect of the voluntary folate fortification policy in Australia on serum folate and total plasma homocysteine (tHcy) concentrations. Design: Population based cohort study. Setting: Perth, Western Australia. Participants: Men and women aged 27 to 77 years (n = 468), who were originally randomly selected from the Perth electoral roll. The cohort was surveyed in 1995/96 before widespread introduction of folate fortification of a variety of foods, and followed up on two occasions, firstly in 1998/99 and again in 2001, when a moderate number of folate fortified foods were available. Subjects with abnormal serum creatinine concentrations at baseline were excluded from this analysis. Main results: Repeated measures analysis of variance was used to determine changes in serum folate and tHcy over the three surveys and to assess whether time trends were related to age, sex, MTHFR C677T genotype, or consumption of folate fortified foods. An increase (38%) in mean serum folate (p < 0.0005) and a decrease (21%) in mean tHcy (p < 0.0005) were seen after introduction of the voluntary folate fortification policy in Australia. Serum folate was consistently higher (p = 0.032) and tHcy was consistently lower (p = 0.001) in subjects who consumed at least one folate fortified food compared with subjects who did not consume any folate fortified foods in the previous week. The time related changes in serum folate and tHcy were affected only by intake of folate fortified foods (p < 0.0005) and not by any other measured variables including age, sex, or MTHFR genotype. Conclusion: Voluntary fortification of foods with folate in Australia has been followed by a substantial increase in serum folate and decrease in tHcy in the general population.
Resumo:
Myb is a key transcription factor that can regulate proliferation, differentiation, and apoptosis, predominantly in the haemopoietic system. Abnormal expression of Myb is associated with a number of cancers, both haemopoietic and non-haemopoietic. In order to better understand the role of Myb in normal and tumorigenic processes, we undertook a cDNA array screen to identify genes that are regulated by this factor. In this way, we identified the gene encoding vascular endothelial growth factor (VEGF) as being potentially regulated by the Myb oncoprotein in myeloid cells. To determine whether this was a direct effect on VEGF gene transcription, we examined the activity of the murine VEGF promoter in the presence of either wild-type (WT) or mutant forms of Myb. It was found that WT Myb was able to activate the VEGF promoter and that a minimal promoter region of 120 bp was sufficient to confer Myb responsiveness. Surprisingly, activation of the VEGF promoter was independent of DNA binding by Myb. This was shown by the use of DNA binding-defective Myb mutants and by mutagenesis of a potential Myb-binding site in the minimal promoter. Mutation of Sp1 sites within this region abolished Myb-mediated regulation of a reporter construct, suggesting that Myb DNA binding-independent activation of VEGF expression occurs via these Sp1 binding elements. Regulation of VEGF production by Myb has implications for the potential role of Myb in myeloid leukaemias and in solid tumours where VEGF may be functioning as an autocrine growth factor. (c) 2006 Elsevier Inc. All rights reserved.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
The rms4 mutant of pea (Pisum sativum L.) was used in grafting studies and cytokinin analyses of the root xylem sap to provide evidence that, at least for pea, the shoot can modify the import of cytokinins from the root. The rms4 mutation, which confers a phenotype with increased branching in the shoot, causes a very substantial decrease (down to 40-fold less) in the concentration of zeatin riboside (ZR) in the xylem sap of the roots. Results from grafts between wild-type (WT) and rms4 plants indicate that the concentration of cytokinins in the xylem sap of the roots is determined almost entirely by the genotype of the shoot. WT scions normalize the cytokinin concentration in the sap of rms4 mutant roots, whereas mutant scions cause WT roots to behave like those of self-grafted mutant plants. The mechanism whereby rms4 shoots of pea cause a down-regulation in the export of cytokinins from the roots is unknown at this time. However, our data provide evidence that the shoot transmits a signal to the roots and thereby controls processes involved in the regulation of cytokinin biosynthesis in the root.
Resumo:
Various members of the bZip and bHLH-Zip families of eukaryotic transcription factors, including Jun, Fos, and Myc, have been identified as oncoproteins; mutation or deregulated expression of these proteins leads to certain types of cancer. These proteins can only bind to their cognate DNA enhancer sites following homodimerization, or heterodimerization with another family member, via their leucine zipper domain. Thus, a novel anticancer strategy would be to inhibit dimerization of these proteins, thereby blocking their DNA binding and transactivation functions. In this paper we show that it is possible to rationally design leucine zipper peptides that bind with high affinity to the leucine zipper dimerization domains of c-Jun and c-Fos, thus preventing the formation of functional c-Jun homodimers and c-Jun:c-Fos heterodimers; we refer to such peptides as superzippers (SZs). In vivo, c-Jun:SZ and c-Fos:SZ heterodimers should be nonfunctional as they lack one of the two basic domains that are essential for DNA binding. While the transport of a peptidic agent into cells often poses a severe obstacle to its therapeutic use, we show that a 46-residue leucine zipper peptide can be transported into HeLa cells by coupling it to a 17-residue carrier peptide from the Antennapedia homeodomain, thus paving the way for detailed studies of the therapeutic potential of superzipper peptides.
Resumo:
Homocystinuria, due to a deficiency of the enzyme cystathionine beta-synthase (CBS), is an inborn error of sulphur-amino acid metabolism, This is an autosomal recessive disease which results in hyperhomocysteinaemia and a wide range of clinical features, including optic lens dislocation, mental retardation, skeletal abnormalities and premature thrombotic events, We report the identification of 5 missense mutations in the protein-coding region of the CBS gene from 3 patients with pyridoxine-nonresponsive homocystinuria. Reverse-transcription PCR was used to amplify CBS cDNA from each patient and the coding region was analysed by direct sequencing, The mutations detected included 3 novel (1058C --> T, 992C --> A and 1316G --> A) and 2 previously identified (430G --> A and 833C --> T) base alterations in the CBS cDNA, Each of these mutations predicts a single amino acid substitution in the CBS polypeptide, Appropriate cassettes of patient CBS cDNA, containing each of the above defined mutations, were used to replace the corresponding cassettes of normal CBS cDNA sequence within the bacterial expression vector pT7-7. These recombinant mutant and normal CBS constructs were expressed in Escherichia coli cells and the catalytic activities of the mutant proteins were compared with normal. All of the mutant proteins exhibited decreased catalytic activity in vitro, which confirmed the association between the individual mutation and CBS dysfunction in each patient.
Resumo:
DsbA, a 21-kDa protein from Escherichia coli, is a potent oxidizing disulfide catalyst required for disulfide bond formation in secreted proteins. The active site of DsbA is similar to that of mammalian protein disulfide isomerases, and includes a reversible disulfide bond formed from cysteines separated by two residues (Cys3O-Pro31-His32-Cys33). Unlike most protein disulfides, the active-site disulfide of DsbA is highly reactive and the oxidized form of DsbA is much less stable than the reduced form at physiological pH. His32, one of the two residues between the active-site cysteines, is critical to the oxidizing power of DsbA and to the relative instability of the protein in the oxidized form. Mutation of this single residue to tyrosine, serine, or leucine results in a significant increase in stability (of similar to 5-7 kcal/mol) of the oxidized His32 variants relative to the oxidized wild-type protein. Despite the dramatic changes in stability, the structures of all three oxidized DsbA His32 Variants are very similar to the wild-type oxidized structure, including conservation of solvent atoms near the active-site residue, Cys3O. These results show that the His32 residue does not exert a conformational effect on the structure of DsbA. The destabilizing effect of His32 on oxidized DsbA is therefore most likely electrostatic in nature.
Resumo:
The identification of genes responsible for the rare cases of familial leukemia may afford insight into the mechanism underlying the more common sporadic occurrences. Here we test a single family with 11 relevant meioses transmitting autosomal dominant acute myelogenous leukemia (AML) and myelodysplasia for linkage to three potential candidate loci. In a different family with inherited AML, linkage to chromosome 21q22.1-22.2 was recently reported; we exclude linkage to 21q22.1-22.2, demonstrating that familial AML is a heterogeneous disease. After reviewing familial leukemia and observing anticipation in the form of a declining age of onset with each generation, we had proposed 9p21-22 and 16q22 as additional candidate loci. Whereas linkage to 9p21-22 can be excluded, the finding of a maximum two-point LOD score of 2.82 with the microsatellite marker D16S522 at a recombination fraction theta = 0 provides evidence supporting linkage to 16q22. Haplotype analysis reveals a 23.5-cM (17.9-Mb) commonly inherited region among all affected family members extending from D16S451 to D1GS289, In order to extract maximum linkage information with missing individuals, incomplete informativeness with individual markers in this interval, and possible deviance from strict autosomal dominant inheritance, we performed nonparametric linkage analysis (NPL) and found a maximum NPL statistic corresponding to a P-value of .00098, close to the maximum conditional probability of linkage expected for a pedigree with this structure. Mutational analysis in this region specifically excludes expansion of the AT-rich minisatellite repeat FRA16B fragile site and the CAG trinucleotide repeat in the E2F-4 transcription factor. The ''repeat expansion detection'' method, capable of detecting dynamic mutation associated with anticipation, more generally excludes large CAG repeat expansion as a cause of leukemia in this family.
Resumo:
The demonstration that mutations in the Patched (PTCH) gene cause nevoid basal cell carcinoma syndrome (NBCCS) has led to the identification of the exact molecular lesion in a percentage of individuals with the syndrome, In addition, it has been possible to determine, through molecular analysis of parents and other relatives of these individuals, if the mutation is inherited or has arisen de novo, We have previously reported 28 mutations in individuals with NBCCS, and here we present an additional 4 novel mutations, We have also analyzed relatives of a number of the individuals in whom we have found mutations, In total we have identified 8 individuals who carry a de novo mutation in the PTCH gene, In 5 of these cases, clinical and radiological examination had not unequivocally ruled out a diagnosis in one of the parents, This helps to define the clinical phenotype and suggests that diagnostic criteria in this complex syndrome may require review. (C) 1997 Wiley-Liss, Inc.
Resumo:
The cDNAs encoding wild type (WT) human receptor tyrosine kinase c-Kit and a constitutively activated mutant, V816Kit, were introduced into granulocyte-macrophage colony-stimulating factor (GM-CSF)-dependent early murine hemopoietic cells, which had been transformed with activated Myb, WTKit cells were able to grow in the presence of the human ligand for Kit, stem cell factor (SCF), but displayed reduced growth and clonogenic potential in either SCF or GM-CSF compared with the parental cells in GM-CSF. In contrast, V816Kit cells grew without factor at a higher rate than the parental cells in GM-CSF and displayed increased clonogenicity. Dissection of the growth characteristics in liquid culture showed that in the presence of appropriate factors, the different populations had similar proliferation rates, but that V816Kit profoundly increased cell survival compared with WTKit or parental cells, This suggests that the signals transduced by WTKit activated with SCF, and by V816Kit, were not identical. Also, WTKit and V816Kit-expressing cells both varied from the early myeloid progenitor phenotype of the parental cells and gave rise to a small number of large to giant adherent cells that expressed macrophage (alpha-naphthyl acetate) esterase and neutrophil (naphtol-AS-D-chloroacetate) esterase, were highly phagocytic and phenotypically resembled histiocytes. Thus, WTKit activated by SCF and V816Kit were able to induce differentiation in a proportion of Myb-transformed myeloid cells. The factor independent V816Kit cells, unlike the parental and WTKit expressing cells, were shown to produce tumors of highly mitotic, invasive cells at various stages of differentiation in syngeneic mice. These results imply that constitutively activated Kit can promote the development of differentiated myeloid tumors and that its oncogenic effects are not restricted to lineages (mast cell and B-cell acute lymphoblastic leukemia), which have been reported previously. Furthermore, the mixed populations of cells in culture and in the tumors phenotypically resembled the leukemic cells from patients with monocytic leukemia with histiocytic differentiation (acute myeloid leukemia-M5c), a newly proposed subtype of myeloid leukemia. (C) 1997 by The American Society of Hematology.