Localization of a brain sulfotransferase, SULT4A1, in the human and rat brain: An immunohistochemical study

Cytosolic sulfotransferases are believed to play a role in the neuromodulation of certain neurotransmitters and drugs. To date, four cytosolic sulfotransferases have been shown to be expressed in human brain. Recently, a novel human brain sulfotransferase has been identified and characterized, although its role and localization in the brain are unknown. Here we present the first immunohistochemical (IHC) localization of SULT4A1 in human brain using an affinity-purified polyclonal antibody raised against recombinant human SULT4A1. These results are supported and supplemented by the IHC localization of SULT4A1 in rat brain. In both human and rat brains, strong reactivity was found in several brain regions, including cerebral cortex, cerebellum, pituitary, and brainstem. Specific signal was entirely absent on sections for which preimmune serum from the corresponding animal, processed in the same way as the postimmune serum, was used in the primary screen. The findings from this study may assist in determining the physiological role of this SULT isoform.

Subtype-selective noncompetitive or competitive inhibition of human alpha(1)-adrenergic receptors by rho-TIA

The 19-amino acid conopeptide (rho-TIA) was shown previously to antagonize noncompetitively alpha(1B)-adrenergic receptors (ARs). Because this is the first peptide ligand for these receptors, we compared its interactions with the three recombinant human alpha(1)-AR subtypes (alpha(1A), alpha(1B), and alpha(1D)). Radioligand binding assays showed that rho-TIA was 10-fold selective for human alpha(1B)- over alpha(1A)- and alpha(1D)-ARs. As observed with hamster alpha(1B)-ARs, rho-TIA decreased the number of binding sites (B-max) for human alpha(1B)-ARs without changing affinity (K-D), and this inhibition was unaffected by the length of incubation but was reversed by washing. However, rho-TIA had opposite effects at human alpha(1A)-ARs and alpha(1D)-ARs, decreasing KD without changing Bmax, suggesting it acts competitively at these subtypes. rho-TIA reduced maximal NE-stimulated [H-3] inositol phosphate formation in HEK293 cells expressing human alpha(1B)-ARs but competitively inhibited responses in cells expressing alpha(1A)- or alpha(1D)-ARs. Truncation mutants showed that the amino-terminal domains of alpha(1B)- or alpha(1D)-ARs are not involved in interaction with rho-TIA. Alanine-scanning mutagenesis of rho-TIA showed F18A had an increased selectivity for alpha(1B)-ARs, and F18N also increased subtype selectivity. I8A had a slightly reduced potency at alpha(1B)-ARs and was found to be a competitive, rather than noncompetitive, inhibitor in both radioligand and functional assays. Thus rho-TIA noncompetitively inhibits alpha(1B)-ARs but competitively inhibits the other two subtypes, and this selectivity can be increased by mutation. These differential interactions do not involve the receptor amino termini and are not because of the charged nature of the peptide, and isoleucine 8 is critical for its noncompetitive inhibition at alpha(1B)-ARs.

The human sulfotransferase SULT1A1 gene is regulated in a synergistic manner by Sp1 and GA binding protein

Human sulfotransferase SULT1A1 is an important phase II xenobiotic metabolizing enzyme that is highly expressed in the liver and mediates the sulfonation of drugs, carcinogens, and steroids. Until this study, the transcriptional regulation of the SULT1A subfamily had been largely unexplored. Preliminary experiments in primary human hepatocytes showed that SULT1A mRNA levels were not changed in response to nuclear receptor activators, such as dexamethasone and 3-methylcolanthrene, unlike other metabolizing enzymes. Using HepG2 cells, the high activity of the TATA-less SULT1A1 promoter was shown to be dependent on the presence of Sp1 and Ets transcription factor binding sites (EBS), located within - 112 nucleotides from the transcriptional start site. The homologous promoter of the closely related SULT1A3 catecholamine sulfotransferase, which is expressed at negligible levels in the adult liver, displayed 70% less activity than SULT1A1. This was shown to be caused by a two-base pair difference in the EBS. The Ets transcription factor GA binding protein (GABP) was shown to bind the SULT1A1 EBS and could transactivate the SULT1A1 promoter in Drosophila melanogaster S2 cells. Cotransfection of Sp1 could synergistically enhance GABP-mediated activation by 10-fold. Although Sp1 and GABP alone could induce SULT1A3 promoter activity, the lack of the EBS on this promoter prevented a synergistic interaction between the two factors. This study reports the first insight into the transcriptional regulation of the SULT1A1 gene and identifies a crucial difference in regulation of the closely related SULT1A3 gene, which accounts for the two enzymes' differential expression patterns observed in the adult liver.

PREDBALB/c: a system for the prediction of peptide binding to H2(d) molecules, a haplotype of the BALB/c mouse

PREDBALB/c is a computational system that predicts peptides binding to the major histocompatibility complex-2 (H2(d)) of the BALB/c mouse, an important laboratory model organism. The predictions include the complete set of H2(d) class I ( H2-K-d, H2-L-d and H2-D-d) and class II (I-E-d and I-A(d)) molecules. The prediction system utilizes quantitative matrices, which were rigorously validated using experimentally determined binders and non-binders and also by in vivo studies using viral proteins. The prediction performance of PREDBALB/c is of very high accuracy. To our knowledge, this is the first online server for the prediction of peptides binding to a complete set of major histocompatibility complex molecules in a model organism (H2(d) haplotype). PREDBALB/c is available at http://antigen.i2r.a-star.edu.sg/predBalbc/.

Disruption of NaS1 sulfate transport function in mice leads to enhanced acetaminophen-induced hepatotoxicity

Sulfate is required for detoxification of xenobiotics such as acetaminophen (APAP), a leading cause of liver failure in humans. The NaS1 sulfate transporter maintains blood sulfate levels sufficiently high for sulforiation reactions to work effectively for drug detoxification. In the present study, we identified two loss-of-function polymorphisms in the human NaS1 gene and showed the Nas1-null mouse to be hypersensitive to APAP hepatotoxicity. APAP treatment led to increased liver damage and decreased hepatic glutathione levels in the hyposulfatemic Nas1-null mice compared with that in normosulfatemic wild-type mice. Analysis of urinary APAP metabolites revealed a significantly lower ratio of APAP-sulfate to APAP-glucuronide in the Nas1-null mice. These results suggest hyposulfatemia increases sensitivity to APAP-induced hepatotoxicity by decreasing the sulfonation capacity to metabolize APAP. In conclusion, the results of this study highlight the importance of plasma sulfate level as a key modulator of acetaminophen metabolism and suggest that individuals with reduced NaS1 sulfate transporter function would be more sensitive to hepatotoxic agents.

Isolation of dopamine D-2 receptor (D2R) promoters in Mugil cephalus

This paper reports the isolation of two putative D2R promoters from grey mullet, one 5' flanking and the other an intronic sequence immediately upstream of the first coding exon. Promoter activity of the intronic sequence was confirmed in vitro through functional analysis using luciferase as reporter gene. The functional characteristics of the region flanking the 5'-UTR is currently under investigation.

Elevated plasma membrane and sarcoplasmic reticulum Ca2+ pump mRNA levels in cultured aortic smooth muscle cells from spontaneously hypertensive rats

We have observed previously that Ca2+ pump-mediated Ca2+ efflux is elevated in cultured aortic smooth muscle cells from spontaneously hypertensive rats compared to those from Wistar-Kyoto rat controls. The objective of this work was to determine if these strains differ in mRNA levels for the PMCA1 isoform of the plasma membrane Ca2+-ATPase and the SERCA2 isoform of the sarcoplasmic reticulum Ca2+-ATPase. mRNA levels were compared in cultured aortic smooth muscle cells from 10-week-old male rats. PMCA1 and SERCA2 mRNA levels were elevated in SHR compared to WKY. Angiotensin II increased the level of PMCA1 and SERCA2 mRNA in both strains. These studies provide further evidence for alterered Ca2+ homeostasis in hypertension at the level of Ca2+ transporting ATPases in the spontaneously hypertensive rat model. These data are also consistent with the hypothesis that the expression of these two Ca2+ pumps may be linked. (C) 1997 Academic Press

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Transfer of Conglomeromonas largomobilis subsp largomobilis to the genus Azospirillum as Azopirillum largomobile comb nov, and elevation of Conglomeromonas largomobilis subsp parooensis to the new type species of Conglomeromonas, Conglomeromonas parooensi

Analysis of the 16S rDNA sequence of Conglomeromonas largomobilis subsp. largomobilis supports a phylogenetic relationship with the species of the genus Azospirillum. This confirms results of previous nucleic acid hybridization studies (FALK, E. C., J. L. JOHNSON, V. D. L. BALDANI, J. DOBEREINER, and N. R. KRIEG. 1986. Int. J. Syst. Bacteriol. 36: 80-85). Conglomeromonas largomobilis subsp. largomobilis was most closely related to the species Azospirillim lipoferum and Azospirillum brasilense but sufficiently distant to warrant separate species status. Conglomeromonas largomobilis subsp. parooensis was more distantly related to the existing species of Azospirillum and represents an isolated subline of descent. On the basis of the phylogenetic evidence a prosposal is made to transfer the subspecies Conglom-eromonas largomobilis subsp. largomobilis to the genus Azospirillum as Azospirillum largomobile comb. nov. and to retain the genus Conglomeromonas by elevating the subspecies C. largomobilis subsp. parooensis to the type species of Conglomeromonas as Conglomeromonas parooensis sp. nov.

The glycine receptor

The inhibitory glycine receptor (GlyR) is a member of the ligand-gated ion channel receptor superfamily. The GlyR comprises a pentameric complex that forms a chloride-selective transmembrane channel, which is predominantly expressed in the spinal cord and brain stem. We review the pharmacological and physiological properties of the GlyR and relate this information to more recent insights that have been obtained through the cloning and recombinant expression of the GlyR subunits. We also discuss insights into our understanding of GlyR structure and function that have been obtained by the genetic characterisation of various heritable disorders of glycinergic neurotransmission. (C) 1997 Elsevier Science Inc.

Transient expression of a novel serine protease in the ectoderm of the ascidian Herdmania momus during development

We have studied gene expression during ascidian embryonic development using the technique of differential display and isolated partial cDNA sequences of 12 genes. Developmental regulation of these genes has been confirmed by northern hybridization analysis. Further cDNA cloning and sequence analysis of an mRNA that is present during gastrulation, neurulation and tailbud formation reveals that it encodes a novel serine protease containing a single kringle motif and catalytic domain. The spatial expression of this gene, designated Hmserp1, is restricted to precursor cells of the epidermis. The structure and expression of Hmsery1 is discussed in relation to possible functions during development.

Genes for albicidin biosynthesis and resistance span at least 69 kb in the genome of Xanthomonas albilineans

All Tn5 insertion mutants of Xanthomonas albilineans, the cause of leaf scald disease of sugar cane, which failed to produce albicidin antibiotics failed to cause chlorosis in inoculated sugar cane but- remained resistant to albicidin. Southern analysis revealed that mutants deficient in albicidin production carried the transposon on different chromosomal restriction fragments spanning at least: 50 kb in the X. albilineans genome, which is larger than any reported cluster of genes involved in the production of a bacterial phytotoxin. Albicidin-resistant cosmid clones from a Tox(-) Tn5 insertion mutant did not carry the transposon, and the subcloned albicidin resistance gene did not hybridize to any of the restriction fragments carrying Tn5 in the Tox(-) mutants, indicating that the albicidin biosynthesis and resistance genes are not closely linked in X. albilineans.

Structure of TcpG, the DsbA protein folding catalyst from Vibrio cholerae

The efficient and correct folding of bacterial disulfide bonded proteins in vivo is dependent upon a class of periplasmic oxidoreductase proteins called DsbA, after the Escherichia coli enzyme. In the pathogenic bacterium Vibrio cholerae, the DsbA homolog (TcpG) is responsible for the folding, maturation and secretion of virulence factors. Mutants in which the tcpg gene has been inactivated are avirulent; they no longer produce functional colonisation pill and they no longer secrete cholera toxin. TcpG is thus a suitable target for inhibitors that could counteract the virulence of this organism, thereby preventing the symptoms of cholera. The crystal structure of oxidized TcpG (refined at a resolution of 2.1 Angstrom) serves as a starting point for the rational design of such inhibitors. As expected, TcpG has the same fold as E. coli DsbA, with which it shares similar to 40% sequence identity. Ln addition, the characteristic surface features of DsbA are present in TcpG, supporting the notion that these features play a functional role. While the overall architecture of TcpG and DsbA is similar and the surface features are retained in TcpG, there are significant differences. For example, the kinked active site helix results from a three-residue loop in DsbA, but is caused by a proline in TcpG (making TcpG more similar to thioredoxin in this respect). Furthermore, the proposed peptide binding groove of TcpG is substantially shortened compared with that of DsbA due to a six-residue deletion. Also, the hydrophobic pocket of TcpG is more shallow and the acidic patch is much less extensive than that of E. coli DsbA. The identification of the structural and surface features that are retained or are divergent in TcpG provides a useful assessment of their functional importance in these protein folding catalysts and is an important prerequisite for the design of TcpG inhibitors. (C) 1997 Academic Press Limited.

A novel method for development of species and strain-specific DNA probes and PCR primers for identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum)

Six Burkholderia solanacearum (formerly Pseudomonas solanacearum) genomic DNA fragments were isolated, using RAPD techniques and cloning, from the three genetically diverse strains: ACH092 (Biovar 4), ACH0158 (Biovar 2) and ACH0171 (Biovar 3) (1). One of these cloned fragments was selected because it was present constantly in all bacterial strains analysed. The remaining five clones were selected because Southern hybridisation revealed that each showed partial or complete specificity towards the strain of origin. A seventh genomic fragment showing a strain-specific distribution in Southern hybridisations was obtained by differential restriction, hybridisation and cloning of genomic DNA. Each of these clones was sequenced and primers to amplify the insert were designed. When DNA from the strain of origin was used as template, PCR amplification for each of these fragments yielded a single band on gel analysis. One pair of primers amplified the species-constant fragment of 281 bp from DNA of all B. solanacearum strains investigated, from DNA of the closely related bacterium which causes ''blood disease'' of banana (BDB) and in P. syzigii. The sensitivity of detection of B. solanacearum using these ubiquitous primers was between 1.3 and 20 bacterial cells. The feasibility and reliability of a PCR approach to detection and identification of B. solanacearum was tested in diverse strains of the bacterium in several countries and laboratories.

Occurrence of cutaneous infections of Myxobolus episquamalis (Myxozoa: Myxobolidae) in sea mullet, Mugil cephalus L, in Australia

Objective To report the occurrence of Myxobolus episquamalis in sea mullet, Mugil cephalus L, caught in estuaries in eastern and western Australia. Design A prospective study of commercial catches of mullet in the Clarence River of NSW and individual cases from other areas. Results The organism caused pale, white to pink, raised lesions on the scales and fins of sea mullet. Occurrence of infection was highest in spring and in a marine (down-river) environment compared to a brackish environment. Up to 6% of fish were affected in commercial catches. Conclusion The infection is widespread in Australian mullet, but rarely causes significant economic loss.