236 resultados para RI EXPRESSION


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The cellular mechanisms coupling mechanical loading with bone remodeling remain unclear. In the CNS, the excitatory amino acid glutamate (Glu) serves as a potent neurotransmitter exerting its effects via various membrane Glu receptors (GluR). Nerves containing Glu exist close to bone cells expressing functional GluRs. Demonstration of a mechanically sensitive glutamate/aspartate transporter protein and the ability of glutamate to stimulate bone resorption in vitro suggest a role for glutamate linking mechanical load and bone remodeling. We used immunohistochemical techniques to identify the expression of N-methyl-D-aspartate acid (NMDA) and non-NMDA (AMPA or kainate) ionotropic GluR subunits on bone cells in vivo. In bone sections from young adult rats, osteoclasts expressed numerous GluR subunits including AMPA (GluR2/3 and GluR4), kainic acid (GluR567) and NMDA (NMDAR2A, NMDAR2B and NMDAR2C) receptor subtypes. Bone lining cells demonstrated immunoexpression for NMDAR2A, NMDAR2B, NMDAR2C, GluR567, GluR23, GuR2 and GluR4 subunits. Immunoexpression was not evident on osteocytes, chondrocytes or vascular channels. To investigate the effects of mechanical loading on GluR expression, we used a Materials Testing System (MTS) to apply 10 N sinusoidal axial compressive loads percutaneously to the right limbs (radius/ulna, tibia/fibula) of rats. Each limb underwent 300-load cycles/day (cycle rate, 1 Hz) for 4 consecutive days. Contralateral, non-loaded limbs served as controls. Mechanically loaded limbs revealed a load-induced loss of immunoexpression for GluR2/3, GluR4, GluR567 and NMDAR2A on osteoclasts and NMDAR2A, NMDAR2B, GluR2/3 and GluR4 on bone lining cells. Both neonatal rabbit and rat osteoclasts were cultured on bone slices to investigate the effect of the NMDA receptor antagonist, MK801, and the AMPA/kainic acid receptor antagonist, NBQX, on osteoclast resorptive activity in vitro. The inhibition of resorptive function seen suggested that both NMDAR and kainic acid receptor function are required for normal osteoclast function. While the exact role of ionotropic GluRs in skeletal tissue remains unclear, the modulation of GluR subunit expression by mechanical loading lends further support for participation of Glu as a mechanical loading effector. These ionotropic receptors appear to be functionally relevant to normal osteoclast resorptive activity. (C) 2005 Elsevier Inc. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Disturbances in iron metabolism often accompany liver disease in humans and hepatic iron deposition is a frequent finding. Since the peptide hepcidin, a major regulator of body iron homeostasis, is synthesised in the liver, alterations in hepcidin expression could be responsible for these effects. To investigate this possibility, we studied hepcidin expression in liver biopsies from patients with hepatitis C virus (HCV) infection, non-alcoholic fatty liver disease (NAFLD) and hemochromatosis (HC). Total RNA was extracted from the liver tissue of 24 HCV, 17 NASH and 5 HC patients, and 17 liver transplant donors (controls). The levels of mRNA for hepcidin and several other molecules involved in iron metabolism (DMT1, Dcytb, hephaestin, ferroportin, TfR1, TfR2, HFE and HJV) were examined by ribonuclease protection assay and expressed relative to the housekeeping gene GAPDH. The expression of hepcidin was significantly decreased in HCV and NASH patients relative to control liver (109±16 and 200±44 versus 325±26 respectively; P=0.008 and 0.02). We have previously reported similar findings in patients with HC, and this was confirmed in the current analysis (176±21; P=0.003). In both HCV and NAFLD patients the expression of the iron reductase Dcytb and the transferrin binding regulatory molecule TfR2 was also decreased, while the cellular iron exporter ferroportin showed a significant increase. Levels of the mRNA for the iron oxidase hephaestin were lower in HCV patients alone, while expression of the major transferrin binding molecule TfR1 was decreased only in NAFLD patients. Of particular interest was the finding that the expression of HJV (which is mutated in patients with juvenile HC) was significantly increased in NAFLD patients. No changes were seen in the expression of the iron importer DMT1 or the regulatory molecule HFE. Decreased expression of hepcidin in patients with HCV and NAFLD provides an explanation why iron homeostasis could be perturbed in these disorders. Reduced hepcidin levels would increase intestinal iron absorption and iron release from macrophages, which could contribute to hepatic iron accumulation. This in turn could lead to alterations in the expression of various proteins involved in iron transport and its regulation. Indeed most of the changes in the expression of such molecules observed in this study are consistent with this. However, the mechanisms leading to changes in the expression of hepcidin in these diseases remain to be elucidated.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of thymic versus peripheral epithelial cells in the negative selection of the peptide-specific CD8 T cell repertoire is still largely unresolved. We have generated TCRb chain transgenic mice in which 20–35% of peripheral CD8 T cells recognize an epitope from a viral, nuclear oncoprotein (human papillomavirus type 16 E7) in the context ofMHC class I, H-2Db. When T cells from these transgenic mice develop through the thymus of a second transgenic mouse expressing E7 from a keratin 14 promoter, no major perturbation to thymic T cell development is observed over a 7 month period. In contrast, peripheral CD8 T cell responses in these same mice (E7TCRxK14E7 double transgenic) become reduced over time. This data suggests that peripheral tolerance mechanisms predominate over thymic negative selection in controlling CD8 T cell responses to this epithelial, nuclear oncoprotein.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cells of the mononuclear phagocyte lineage possess receptors for macrophage colony-stimulating factor (CSF-1) encoded by the c-fms protooncogene and respond to CSF-1 with increased survival, growth, differentiation, and reversible changes in function. The c-fms gene is itself a macrophage differentiation marker. In whole mount analyses of mRNA expression in embryos, c-fms is expressed at very high levels on placental trophoblasts. It is detectable on individual cells in the yolk sac around 8.5 to 9 days postcoitus, appears on isolated cells in the head of the embryo around 9.5 dpc, and appears on numerous cells throughout the embryo by day 10.5. The extent of c-fms expression is much greater than for other macrophage-specific genes including lysozyme and a macrophage-specific protein tyrosine phosphatase. Our studies of the cis-acting elements of the c-fms promoter have indicated a key role for collaboration between the macrophage-specific transcription factor, Pu.1, which functions in determining the site of transcription initiation, and other members of the Ets transcription factor family. This is emerging as a common pattern in macrophage-specific promoters. We have shown that two PU box elements alone can function as a macrophage-specific promoter. The activity of both the artifical promoter and the c-fms promoter is activated synergistically by coexpression of Pu.1 and another Ets factor, c-Ets-2. A 3.5kb c-fms exon 2 promoter (but not the 300bp proximal promoter) is also active in a wide diversity of tumor cell lines. The interesting exception is the melanoma cell line K1735, in which the promoter is completely shut down and expression of c-fms causes growth arrest and cell death. The activity of the exon 2 promoter in these nonmacrophages is at least as serum responsive as the classic serum-responsive promoter of the c-fos gene. It is further inducible in nonmacrophages by coexpression of the c-fms product. Unlike other CSF-1/c-fms-responsive promoters, the c-fms promoter is not responsive to activated Ras even when c-Ets-2 is coexpressed. In most lines, production of full length c-fms is prevented by a downstream intronic terminator, but in Lewis lung carcinoma, read-through does occur, and expression of both c-fms and other macrophage-specific genes such as lysozyme and urokinase becomes detectable in conditions of serum deprivation. (C) 1997 Wiley-Liss, Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Phytophthora-resistant lucerne cultivars do not always perform well under conditions of high disease pressure in the field. To determine whether resistance expression remains stable under different infection intensities, tetraploid and diploid lucerne genotypes, genotypically defined for their reactions to Phytophthora medicaginis, were clonally propagated, and the influence of different reproducible inoculum levels (0 . 5 and 5 . 0 g dry weight mycelium/kg dry weight potting mix), the period of exposure to these levels (10-60 days), and temperature (16/22 degrees C and 24/30 degrees C) on disease expression was determined in controlled environments. Generally, expression of resistance by resistant genotypes, remained stable under these conditions. Biotic (e.g. Aphanomyces eutiches) or abiotic factors other than P. medicaginis may be responsible for the poorer than expected performance under field conditions in some instances, or the percentage of resistant plants in some cultivars currently classified as resistant is insufficient to provide buffering against productivity reductions under severe epidemics. Further research is needed to clarify the situation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective. Circumstantial evidence links retroviruses (RVs) with human autoimmune diseases, The aim of the present study was to obtain direct evidence of RV gene expression in rheumatoid arthritis (RA). Methods. Synovial samples were obtained from patients with RA, patients with osteoarthritis (OA), and normal control subjects, Reverse transcription-polymerase chain reaction (RT-PCR) was performed using synovial RNA and primers to conserved sequences in the polymerase (pol) genes of known RVs. Results. PCR products (n = 857) were cloned and sequenced, Multiple pol transcripts, many with open reading frames, were expressed in every sample, Sequences were aligned and classified into 6 families (F1-F6) that contained 33 groups of known and unknown endogenous RVs (ERVs), each distinguished by a specific, deduced peptide motif, The frequency of sequences in each family was similar between RA, OA, and normal synovial tissue, but differed significantly in RA synovial fluid cells, F1 sequences (undefined, but related to murine and primate type C RVs) were lower in frequency, F2 (ERV-9-related), F4 (HERV-K-related), and F6 (HERV-L-related) sequences were higher in frequency, and F3 (RTVL-H-related) sequences were not detected, in the RA synovial fluid cells compared with the RA synovial tissues. Conclusion. Multiple ERVs are expressed in normal and diseased synovial compartments, but specific transcripts can be differentially expressed in RA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have studied gene expression during ascidian embryonic development using the technique of differential display and isolated partial cDNA sequences of 12 genes. Developmental regulation of these genes has been confirmed by northern hybridization analysis. Further cDNA cloning and sequence analysis of an mRNA that is present during gastrulation, neurulation and tailbud formation reveals that it encodes a novel serine protease containing a single kringle motif and catalytic domain. The spatial expression of this gene, designated Hmserp1, is restricted to precursor cells of the epidermis. The structure and expression of Hmsery1 is discussed in relation to possible functions during development.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The spatial and temporal association of muscle-specific tropomyosin gene expression, and myofibril assembly and degradation during metamorphosis is analyzed in the gastropod mollusc. Haliotis rufescens. Metamorphosis of tile planktonic larva to the benthic juvenile includes rearrangement and atrophy of specific larval muscles, and biogenesis of the new juvenile muscle system. The major muscle of the larva - the larval retractor muscle - reorganizes at metamorphosis, with two suites of cells having different fates. The ventral cells degenerate, while the dorsal cells become part of the developing juvenile mantle musculature. Prior to these changes in myofibrillar structure, tropomyosin mRNA prevalence declines until undetectable in the ventral cells, while increasing markedly in the dorsal cells. In the foot muscle and right shell muscle, tropomyosin mRNA levels remain relatively stable, even trough myofibril content increases. In a population of median mesoderm cells destined to form de novo the major muscle of the juvenile and adult (the columellar muscle), tropomyosin expression is initiated at 45 h after induction of metamorphosis. Myofibrillar filamentous actin is not detected in these cells until about 7 days later. Given that patterns of tropomyosin mRNA accumulation in relation to myofibril assembly and disassembly differ significantly among the four major muscle systems examined, we suggest that different regulatory mechanisms, probably operating at both transcriptional and post-transcriptional levels, control the biogenesis and atrophy of different larval and postlarval muscles at metamorphosis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Elevated concentrations of plasma tumour necrosis factor (TNF)-alpha, interleukin (IL)-1 and IL-6 have been detected in patients with alcoholic hepatitis and have been implicated in the pathogenesis of hepatocyte necrosis. The present study used a rat model to conduct a detailed histological and biochemical examination of the expression of various pro-inflammatory cytokines and associated liver pathology in ethanol-potentiated lipopolysaccharide (LPS)-induced liver injury. Male Wistar rats were pair-fed either the control or ethanol-containing (36% of caloric intake as ethanol) form of the Lieber-DeCarli liquid diet for 6 weeks. Liver injury was induced by the i.v. injection of LPS (1 mu g/g bodyweight), with animals being killed at O, 1, 3, 6, 12 and 24 h after injection. At the later time points, plasma transaminase and transpeptidase activities were significantly elevated in ethanol-fed LPS-treated rats compared with control-fed LPS-treated animals. At these times after LPS treatment, hepatocytes in ethanol-fed animals displayed fatty change and necrosis with an associated neutrophil polymorph infiltrate. Time course analysis revealed that plasma TNF-alpha (1-3 h post-LPS) and IL-6 (3 h post-LPS) bioactivity was significantly elevated in ethanol-fed compared with control-fed animals. No difference was seen in plasma IL-1 alpha concentration (maximal in both groups 6 h post-LPS). The expression of TNF-alpha, IL-1 alpha, IL-1 beta and IL-6 mRNA were elevated between 1 and 6 h post-LPS in the livers of both control and ethanol-fed rats. However, ethanol-fed LPS-treated animals exhibited significantly higher maximal expression of IL-1 and IL-6 mRNA. Comparison of the appearance of cytokine mRNA and plasma bioactivity indicated an effect of ethanol feeding on post-transcriptional processing and/or the kinetics of the circulating cytokines. Elevated levels of both hepatic cytokine mRNA expression and the preceding plasma cytokines are presumably a necessary prerequisite for hepatic injury seen in this model and, therefore, possibly for the damage seen in human alcoholics. Further studies using this model may lead to significant advances in our understanding of the pathogenic mechanisms of alcoholic liver disease in humans.