The role of dogs in transmission of gastrointestinal parasites in a remote tea-growing community in northeastern India

The prevalence and risk factors associated with canine gastrointestinal parasitic zoonoses and the role of dogs in the mechanical transmission of human Ascaris infection was examined in three tea estates in Assam, India. Nearly all (99%) dogs harbored one or more zoonotic species of gastrointestinal parasites, with hookworm infection being most common (94%). Parasitic stages presumed to be host-specific for humans such as Ascaris spp. (31%), Trichuris trichiura (25%), and Isospora belli (2%) were also recovered from dog feces. A polymerase chain reaction-linked restriction fragment length polymorphism technique was used to differentiate the species of Ascaris eggs in dog feces. The results of this study demonstrate the role of the dog as a significant disseminator and environmental contaminator of Ascaris lumbricoides in communities where promiscuous defecation by humans occurs.

Patterns of variation within self-incompatibility loci

Diverse self-incompatibility (SI) mechanisms permit flowering plants to inhibit fertilization by pollen that express specificities in common with the pistil. Characteristic of at least two model systems is greatly reduced recombination across large genomic tracts surrounding the S-locus, which regulates SI. In three angiosperm families, including the Solanaceae, the gene that controls the expression of gametophytic SI in the pistil encodes a ribonuclease (S-RNase). The gene that controls pollen SI expression is currently unknown, although several candidates have recently been proposed. Although each candidate shows a high level of polymorphism and complete allelic disequilibrium with the S-RNase gene, such properties may merely reflect tight linkage to the S-locus, irrespective of any functional role in SI. We analyzed the magnitude and nature of nucleotide variation, with the objective of distinguishing likely candidates for regulators of SI from other genes embedded in the S-locus region. We studied the S-RNase gene of the Solanaceae and 48A, a candidate for the pollen gene in this system, and we also conducted a parallel analysis of the regulators of sporophytic SI in Brassica, a system in which both the pistil and pollen genes are known. Although the pattern of variation shown by the pollen gene of the Brassica system is consistent with its role as a determinant of pollen specificity, that of 48A departs from expectation. Our analysis further suggests that recombination between 48A and S-RNase may have occurred during the interval spanned by the gene genealogy, another indication that 48A may not regulate SI expression in pollen.

Association of tumor necrosis factor-alpha polymorphisms and ozone-induced change in lung function

Ozone is a major air pollutant with adverse health effects which exhibit marked inter-individual variability. In mice, regions of genetic linkage with ozone-induced lung injury include the tumor necrosis factor-alpha (TNF), lymphotoxin-alpha (LTA), Toll-like receptor 4 (TLR4), superoxide dismutase (SOD2), and glutathione peroxidase (GPX1) genes. We genotyped polymorphisms in these genes in 51 individuals who had undergone ozone challenge. Mean change in FEV1 with ozone challenge, as a percentage of baseline, was -3% in TNF -308G/A or A/A individuals, compared with -9% in G/G individuals (p = 0.024). When considering TNF haplotypes, the smallest change in FEV1 with ozone exposure was associated with the TNF haplotype comprising LTA +252G/TNF -1031T/TNF -308A/TNF -238G. This association remained statistically significant after correction for age, sex, disease, and ozone concentration (p = 0.047). SOD2 or GPX1 genotypes were not associated with lung function, and the TLR4 polymorphism was too infrequent to analyze. The results of this study support TNF as a genetic factor for susceptibility to ozone-induced changes in lung function in humans, and has potential implications for stratifying health risks of air pollution.

Association between dopamine transporter (DATI) genotype, left-sided inattention, and an enhanced response to methylphenidate in attention-deficit hyperactivity disorder

A polymorphism of the dopamine transporter gene (DAT1, 10-repeat) is associated with attention-deficit hyperactivity disorder (ADHD) and has been linked to an enhanced response to methylphenidate (MPH). One aspect of the attention deficit in ADHD includes a subtle inattention to left space, resembling that seen after right cerebral hemisphere damage. Since left-sided inattention in ADHD may resolve when treated with MPH, we asked whether left-sided inattention in ADHD was related to DAT1 genotype and the therapeutic efficacy of MPH. A total of 43 ADHD children and their parents were genotyped for the DAT1 30 variable number of tandem repeats polymorphism. The children performed the Landmark Test, a well-validated measure yielding a spatial attentional asymmetry index ( leftward to rightward attentional bias). Parents rated their child's response to MPH retrospectively using a three-point scale ( no, mediocre or very good response). Additionally, parents used a symptom checklist to rate behavior while on and off medication. A within-family control design determined whether asymmetry indices predicted biased transmission of 10-repeat parental DAT1 alleles and/or response to MPH. It was found that left-sided inattention predicted transmission of the 10-repeat allele from parents to probands and was associated with the severity of ADHD symptomatology. Children rated as achieving a very good response to MPH displayed left-sided inattention, while those rated as achieving a poorer response did not. Our results suggest a subgroup of children with ADHD for whom the 10-repeat DAT1 allele is associated with left-sided inattention. MPH may be most efficacious in this group because it ameliorates a DAT1-mediated hypodopaminergic state.

Cholestanol: A serum marker to guide LDL cholesterol-lowering therapy

Statins have been the mainstay of lipid-lowering therapy since their introduction. However, as lower LDL cholesterol targets are sought, adjunct therapies are becoming increasingly important. Few patients reach new targets with statin monotherapy. We propose that the cholestanol: cholesterol ratio can be used to guide lipid-lowering therapy and result in greater numbers of patients reaching target LDL cholesterol. By determining whether a patient is mainly a synthesizer or absorber of cholesterol, customized regimens can be used and are expected to improve patient outcomes and minimize costs of treatment. (c) 2005 Elsevier Ireland Ltd. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Metabolic activation of aromatic amines by human pancreas

Epidemiologic studies have suggested that aromatic amines (and nitroaromatic hydrocarbons) may be carcinogenic for human pancreas, Pancreatic tissues from 29 organ donors (13 smokers, 16 non-smokers) were examined for their ability to metabolize aromatic amines and other carcinogens, Microsomes showed no activity for cytochrome P450 (P450) 1A2-dependent N-oxidation of 4-aminobiphenyl (ABP) or for the following activities (and associated P450s): aminopyrine N-demethylation and ethylmorphine N-demethylation (P450 3A4); ethoxyresorufin O-deethylation (P450 1A1) and pentoxyresorufin O-dealkylation (P450 2B6); p-nitrophenol hydroxylation and N-nitrosodimethylamine N-demethylation (P450 2E1); lauric acid omega-hydroxylation (P450 4A1); and 4-(methylnitrosamino)-1-(3-pyridyl-1-butanol) (NNAL) and 4-(methylnitrosamino)1-(3-pyridyl)-1-butanone (NNK) alpha-oxidation (P450 1A2, 2A6, 2D6). Antibodies were used to examine microsomal levels of P450 1A2, 2A6, 2C8/9/18/19, 2E1, 2D6, and 3A3/ 4/5/7 and epoxide hydrolase. Immunoblots detected only epoxide hydrolase at low levels; P450 levels were <1% of liver. Microsomal benzidine/prostaglandin hydroperoxidation activity was low. In pancreatic cytosols and microsomes, 4-nitrobiphenyl reductase activities were present at levels comparable to human liver. The O-acetyltransferase activity (AcCoA-dependent DNA-binding of [H-3]N-hydroxy-ABP) of pancreatic cytosols was high, about two-thirds the levels measured in human colon. Cytosols showed high activity for N-acetylation of p-aminobenzoic acid, but not of sulfamethazine, indicating that acetyltransferase-1 (NAT1) is predominantly expressed in this tissue. Cytosolic sulfotransferase was detected at low levels. Using P-32-post-labeling enhanced by butanol extraction, putative arylamine-DNA adducts were detected in most samples. Moreover, in eight of 29 DNA samples, a major adduct was observed that was chromatographically identical to the predominant ABP-DNA adduct, N-(deoxyguanosin-8-yl)-ABP. These results are consistent with a hypothesis that aromatic amines and nitroaromatic hydrocarbons may be involved in the etiology of human pancreatic cancer.

Population structure of Phytophthora cinnamomi in South Africa

Phytophthora cinnamomi isolates collected from 1977 to 1986 and 1991 to 1993 in two regions in South Africa were analyzed using isozymes. A total of 135 isolates was analyzed for 14 enzymes representing 20 putative loci, of which four were polymorphic. This led to the identification of nine different multilocus isozyme genotypes. Both mating types of P. cinnamomi occurred commonly in the Cape region, whereas, predominantly, the A2 mating type occurred in the Mpumalanga region of South Africa. A2 mating type isolates could be resolved into seven multilocus isozyme genotypes, compared with only two multilocus isozyme genotypes for the A1 mating type isolates. Low levels of gene (0.115) and genotypic (2.4%) diversity and a low number of alleles per locus (1.43) were observed for the South African P. cinnamomi population. The genetic distance between the Cape and Mpumalanga P. cinnamomi populations was relatively low (D-m = 0.165), and no specific pattern in regional distribution of multilocus isozyme genotypes could be observed. The genetic distance between the ''old'' (isolated between 1977 and 1986) and ''new'' (isolated between 1991 and 1993) P. cinnamomi populations from the Cape was low (D-m = 0.164), indicating a stable population over time. Three of the nine multilocus isozyme genotypes were specific to the ''old'' population, and only one multilocus isozyme genotype was specific to the ''new'' population. Significant differences in allele frequencies, a high genetic distance (D-m = 0.581) between the Cape A1 and A2 mating type isolates, significant deviations from Hardy-Weinberg equilibrium, a low overall level of heterozygosity, and a high fixation index (0.71) all indicate that sexual reproduction occurs rarely, if at all, in the South African P. cinnamomi population.

Application of inter simple sequence repeat (ISSR) markers to plant genetics

Microsatellites or simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Single-locus SSR markers have been developed for a number of species, although there is a major bottleneck in developing SSR markers whereby flanking sequences must be known to design 5'-anchors for polymerase chain reaction (PCR) primers. Inter SSR (ISSR) fingerprinting was developed such that no sequence knowledge was required. Primers based on a repeat sequence, such as (CA)(n), can be made with a degenerate 3'-anchor, such as (CA)(8)RG or (AGC)(6)TY. The resultant PCR reaction amplifies the sequence between two SSRs, yielding a multilocus marker system useful for fingerprinting, diversity analysis and genome mapping. PCR products are radiolabelled with P-32 or P-33 via end-labelling or PCR incorporation, and separated on a polyacrylamide sequencing gel prior to autoradiographic visualisation. A typical reaction yields 20-100 bands per lane depending on the species and primer. We have used ISSR fingerprinting in a number of plant species, and report here some results on two important tropical species, sorghum and banana. Previous investigators have demonstrated that ISSR analysis usually detects a higher level of polymorphism than that detected with restriction fragment length polymorphism (RFLP) or random amplified polymorphic DNA (RAPD) analyses. Our data indicate that this is not a result of greater polymorphism genetically, but rather technical reasons related to the detection methodology used for ISSR analysis.