Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Translational incorporation of L-3,4-dihydroxyphenylalanine into proteins

An Escherichia coli cell-free transcription/translation system was used to explore the high-level incorporation Of L-3,4-dihydroxyphenylalanine (DOPA) into proteins by replacing tyrosine with DOPA in the reaction mixtures. ESI-MS showed specific incorporation of DOPA in place of tyrosine. More than 90% DOPA incorporation at each tyrosine site was achieved, allowing the recording of clean N-15-HSQC NMR spectra. A redox-staining method specific for DOPA was shown to provide a sensitive and generally applicable method for assessing the cell-free production of proteins. Of four proteins produced in soluble form in the presence of tyrosine, two resulted in insoluble aggregates in the presence of high levels of DOPA. DOPA has been found in human proteins, often in association with various disease states that implicate protein aggregation and/or misfolding. Our results suggest that misfolded and aggregated proteins may result, in principle, from ribosome-mediated misincorporation of intracellular DOPA accumulated due to oxidative stress. High-yield cell-free protein expression systems are uniquely suited to obtain rapid information on solubility and aggregation of nascent polypeptide chains.

The crystal structure of free human hypoxanthineguanine phosphoribosyltransferase reveals extensive conformational plasticity throughout the catalytic cycle

Human hypoxanthine-guanine phosphoribosyltransferase (HGPRT) catalyses the synthesis of the purine nucleoside monophosphates, IMP and GMP, by the addition of a 6-oxopurine base, either hypoxanthine or guanine, to the 1-beta-position of 5-phospho-U-D-ribosyl-1-pyrophosphate (PRib-PP). The mechanism is sequential, with PRib-PP binding to the free enzyme prior to the base. After the covalent reaction, pyrophosphate is released followed by the nucleoside monophosphate. A number of snapshots of the structure of this enzyme along the reaction pathway have been captured. These include the structure in the presence of the inactive purine base analogue, 7-hydroxy [4,3-d] pyrazolo pyrimidine (HPP) and PRib-PP. Mg2+, and in complex with IMP or GMP. The third structure is that of the immucillinHP.Mg2+.PPi complex, a transition-state analogue. Here, the first crystal structure of free human HGPRT is reported to 1.9 angstrom resolution, showing that significant conformational changes have to occur for the substrate(s) to bind and for catalysis to proceed. Included in these changes are relative movement of subunits within the tetramer, rotation and extension of an active-site alpha-helix (D137-D153), reorientation of key active-site residues K68, D137 and K165, and the rearrangement of three active-site loops (100-128, 165-173 and 186-196). Toxoplasina gondii HGXPRT is the only other 6-oxopurine phosphoribosyltransferase structure solved in the absence of ligands. Comparison of this structure with human HGPRT reveals significant differences in the two active sites, including the structure of the flexible loop containing K68 (human) or K79 (T gondii). (c) 2005 Elsevier Ltd. All rights reserved.

Adoptive transfer of gene-engineered CD4+ helper T cells induces potent primary and secondary tumor rejection

Because CD4(+) T cells play a key role in aiding cellular immune responses, we wanted to assess whether increasing numbers of gene-engineered antigen-restricted CD4(+) T cells could enhance an antitumor response mediated by similarly gene-engineered CD8(+) T cells. In this study, we have used retroviral transduction to generate erbB2-reactive mouse T-cell populations composed of various proportions of CD4(+) and CD8(+) cells and then determined the antitumor reactivity of these mixtures. Gene-modified CD4(+) and CD8(+) T cells were shown to specifically secrete Tc1 (T cytotoxic-1) or Tc2 cytokines, proliferate, and lyse erbB2(+) tumor targets following antigen ligation in vitro. In adoptive transfer experiments using severe combined immunodeficient (scid) mice, we demonstrated that injection of equivalent numbers of antigen-specific engineered CD8(+) and CD4(+) T cells led to significant improvement in survival of mice bearing established lung metastases compared with transfer of unfractionated (largely CD8(+)) engineered T cells. Transferred CD4(+) T cells had to be antigen-specific (not just activated) and secrete interferon gamma (IFN-gamma) to potentiate the antitumor effect. Importantly, antitumor responses in these mice correlated with localization and persistence of gene-engineered T cells at the tumor site. Strikingly, mice that survived primary tumor challenge could reject a subsequent re-challenge. Overall, this study has highlighted the therapeutic potential of using combined transfer of antigen-specific gene-modified CD8(+) and CD4(+) T cells to significantly enhance T-cell adoptive transfer strategies for cancer therapy.

Prevalence and correlates of the injection of methadone syrup in Sydney, Australia

A sample of 312 heroin users was interviewed on their injection of methadone syrup. Methadone injecting was widespread, with 52% of subjects having injected methadone syrup, 29% in the preceding six months. Males and females were equally likely to report methadone injecting. Forty per cent Of current methadone injectors reported weekly or more frequent methadone injecting over the preceding six months. A history of methadone injecting was;associated with abscesses and infections in injection sites, having been diagnosed with a venous thrombosis and a history of heroin overdose. Current methadone injectors were in poorer general health, had more injection-related symptoms, higher levels of psychological distress, were more likely to have recently passed on used injecting equipment and to have recently committed criminal acts. Implications for the reduction in the prevalence of methadone injecting and associated harm are discussed.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

The structure of versutoxin (delta-atracotoxin-Hv1) provides insights into the binding of site 3 neurotoxins to the voltage-gated sodium channel

Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.