Review of genetic and epigenetic alterations in hepatocarcinogenesis

Hepatocellular carcinoma (HCC) is associated with multiple risk factors and is believed to arise from pre-neoplastic lesions, usually in the background of cirrhosis. However, the genetic and epigenetic events of hepatocarcinogenesis are relatively poorly understood. HCC display gross genomic alterations, including chromosomal instability (CIN), CpG island methylation, DNA rearrangements associated with hepatitis B virus (HBV) DNA integration, DNA hypomethylation and, to a lesser degree, microsatellite instability. Various studies have reported CIN at chromosomal regions, 1p, 4q, 5q, 6q, 8p, 10q, 11p, 16p, 16q, 17p and 22q. Frequent promoter hypermethylation and subsequent loss of protein expression has also been demonstrated in HCC at tumor suppressor gene (TSG), p16, p14, p15, SOCS1, RIZ1, E-cadherin and 14-3-3 sigma. An interesting observation emerging from these studies is the presence of a methylator phenotype in hepatocarcinogenesis, although it does not seem advantageous to have high levels of microsatellite instability. Methylation also appears to be an early event, suggesting that this may precede cirrhosis. However, these genes have been studied in isolation and global studies of methylator phenotype are required to assess the significance of epigenetic silencing in hepatocarcinogenesis. Based on previous data there are obvious fundamental differences in the mechanisms of hepatic carcinogenesis, with at least two distinct mechanisms of malignant transformation in the liver, related to CIN and CpG island methylation. The reason for these differences and the relative importance of these mechanisms are not clear but likely relate to the etiopathogenesis of HCC. Defining these broad mechanisms is a necessary prelude to determine the timing of events in malignant transformation of the liver and to investigate the role of known risk factors for HCC.

Numerical simulation of double-diffusion driven convective flow and rock alteration in three-dimensional fluid-saturated geological fault zones

Numerical methods are used to simulate the double-diffusion driven convective pore-fluid flow and rock alteration in three-dimensional fluid-saturated geological fault zones. The double diffusion is caused by a combination of both the positive upward temperature gradient and the positive downward salinity concentration gradient within a three-dimensional fluid-saturated geological fault zone, which is assumed to be more permeable than its surrounding rocks. In order to ensure the physical meaningfulness of the obtained numerical solutions, the numerical method used in this study is validated by a benchmark problem, for which the analytical solution to the critical Rayleigh number of the system is available. The theoretical value of the critical Rayleigh number of a three-dimensional fluid-saturated geological fault zone system can be used to judge whether or not the double-diffusion driven convective pore-fluid flow can take place within the system. After the possibility of triggering the double-diffusion driven convective pore-fluid flow is theoretically validated for the numerical model of a three-dimensional fluid-saturated geological fault zone system, the corresponding numerical solutions for the convective flow and temperature are directly coupled with a geochemical system. Through the numerical simulation of the coupled system between the convective fluid flow, heat transfer, mass transport and chemical reactions, we have investigated the effect of the double-diffusion driven convective pore-fluid flow on the rock alteration, which is the direct consequence of mineral redistribution due to its dissolution, transportation and precipitation, within the three-dimensional fluid-saturated geological fault zone system. (c) 2005 Elsevier B.V. All rights reserved.

Three-dimensional model for multi-component reactive transport with variable density groundwater flow

PHWAT is a new model that couples a geochemical reaction model (PHREEQC-2) with a density-dependent groundwater flow and solute transport model (SEAWAT) using the split-operator approach. PHWAT was developed to simulate multi-component reactive transport in variable density groundwater flow. Fluid density in PHWAT depends not on only the concentration of a single species as in SEAWAT, but also the concentrations of other dissolved chemicals that can be subject to reactive processes. Simulation results of PHWAT and PHREEQC-2 were compared in their predictions of effluent concentration from a column experiment. Both models produced identical results, showing that PHWAT has correctly coupled the sub-packages. PHWAT was then applied to the simulation of a tank experiment in which seawater intrusion was accompanied by cation exchange. The density dependence of the intrusion and the snow-plough effect in the breakthrough curves were reflected in the model simulations, which were in good agreement with the measured breakthrough data. Comparison simulations that, in turn, excluded density effects and reactions allowed us to quantify the marked effect of ignoring these processes. Next, we explored numerical issues involved in the practical application of PHWAT using the example of a dense plume flowing into a tank containing fresh water. It was shown that PHWAT could model physically unstable flow and that numerical instabilities were suppressed. Physical instability developed in the model in accordance with the increase of the modified Rayleigh number for density-dependent flow, in agreement with previous research. (c) 2004 Elsevier Ltd. All rights reserved.

Multifidus muscle recovery is not automatic after resolution of acute, first-episode low back pain

Study Design. A clinical study was conducted on 39 patients with acute, first-episode, unilateral low back pain and unilateral, segmental inhibition of the multifidus muscle. Patients were allocated randomly to a control or treatment group. Objectives. To document the natural course of lumbar multifidus recovery and to evaluate the effectiveness of specific, localized, exercise therapy on muscle recovery. Summary of Background Data. Acute low back pain usually resolves spontaneously, but the recurrence rate is high. Inhibition of multifidus occurs with acute, first-episode, low back pain, and pathologic changes in this muscle have been linked with poor outcome and recurrence of symptoms. Methods. Patients in group 1 received medical treatment only. Patients in group 2 received medical treatment and specific, localized, exercise therapy. Outcome measures for both groups included 4 weekly assessments of pain, disability, range of motion, and size of the multifidus cross-sectional area. Independent examiners were blinded to group allocation. Patients were reassessed at a 10-week follow-up examination. Results. Multifidus muscle recovery was not spontaneous on remission of painful symptoms in patients in group 1. Muscle recovery was more rapid and more complete in patients in group 2 who received exercise therapy (P = 0.0001). Other outcome measurements were similar for the two groups at the 4-week examination. Although they resumed normal levels of activity, patients in group 1 still had decreased multifidus muscle size at the 10-week follow-up examination. Conclusions. Multifidus muscle recovery is not spontaneous on remission of painful symptoms. Lack of localized, muscle support may be one reason for the high recurrence rate of low back pain following the initial episode.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

A low-temperature insulating phase at v=1.5 for 2D holes in high-mobility SiSi1-xGex heterostructures with Landau level degeneracy

Magneto-transport measurements of the 2D hole system (2DHS) in p-type Si-Si1-xGex heterostructures identify the integer quantum Hall effect (IQHE) at dominantly odd-integer filling factors v and two low-temperature insulating phases (IPs) at v = 1.5 and v less than or similar to 0.5, with re-entrance to the quantum Hall effect at v = 1. The temperature dependence, current-voltage characteristics, and tilted field and illumination responses of the IP at v = 1.5 indicate that the important physics is associated with an energy degeneracy of adjacent Landau levels of opposite spin, which provides a basis for consideration of an intrinsic, many-body origin.

Self-organization with traveling waves: A case for a convective torus

A traveling wave of BaSO4 in the chlorite-thiourea reaction has shown concentric precipitation patterns upon being triggered by the autocatalyst HOCl. The precipitation patterns show circular rings of alternate null and full precipitation regions. This self-organization appears to be the result of the formation of a convective torus. The formation of the convective torus can be described as a Benard-Marangoni instability with lateral heating.

Structural analysis of three His32 mutants of DsbA: Support for an electrostatic role of His32 in DsbA stability

DsbA, a 21-kDa protein from Escherichia coli, is a potent oxidizing disulfide catalyst required for disulfide bond formation in secreted proteins. The active site of DsbA is similar to that of mammalian protein disulfide isomerases, and includes a reversible disulfide bond formed from cysteines separated by two residues (Cys3O-Pro31-His32-Cys33). Unlike most protein disulfides, the active-site disulfide of DsbA is highly reactive and the oxidized form of DsbA is much less stable than the reduced form at physiological pH. His32, one of the two residues between the active-site cysteines, is critical to the oxidizing power of DsbA and to the relative instability of the protein in the oxidized form. Mutation of this single residue to tyrosine, serine, or leucine results in a significant increase in stability (of similar to 5-7 kcal/mol) of the oxidized His32 variants relative to the oxidized wild-type protein. Despite the dramatic changes in stability, the structures of all three oxidized DsbA His32 Variants are very similar to the wild-type oxidized structure, including conservation of solvent atoms near the active-site residue, Cys3O. These results show that the His32 residue does not exert a conformational effect on the structure of DsbA. The destabilizing effect of His32 on oxidized DsbA is therefore most likely electrostatic in nature.

The subcycled Newmark algorithm

The popular Newmark algorithm, used for implicit direct integration of structural dynamics, is extended by means of a nodal partition to permit use of different timesteps in different regions of a structural model. The algorithm developed has as a special case an explicit-explicit subcycling algorithm previously reported by Belytschko, Yen and Mullen. That algorithm has been shown, in the absence of damping or other energy dissipation, to exhibit instability over narrow timestep ranges that become narrower as the number of degrees of freedom increases, making them unlikely to be encountered in practice. The present algorithm avoids such instabilities in the case of a one to two timestep ratio (two subcycles), achieving unconditional stability in an exponential sense for a linear problem. However, with three or more subcycles, the trapezoidal rule exhibits stability that becomes conditional, falling towards that of the central difference method as the number of subcycles increases. Instabilities over narrow timestep ranges, that become narrower as the model size increases, also appear with three or more subcycles. However by moving the partition between timesteps one row of elements into the region suitable for integration with the larger timestep these the unstable timestep ranges become extremely narrow, even in simple systems with a few degrees of freedom. As well, accuracy is improved. Use of a version of the Newmark algorithm that dissipates high frequencies minimises or eliminates these narrow bands of instability. Viscous damping is also shown to remove these instabilities, at the expense of having more effect on the low frequency response.

HPP1: A transmembrane protein-encoding gene commonly methylated in colorectal polyps and cancers

Adenomas are the precursors of most colorectal cancers. Hyperplastic polyps have been linked to the subset of colorectal cancers showing DNA microsatellite instability, but little is known of their underlying genetic etiology. Using a strategy that isolates differentially methylated sequences from hyperplastic polyps and normal mucosa, we identified a 370-bp sequence containing the 5' untranslated region and the first exon of a gene that we have called HPP1. Rapid amplification of cDNA ends was used to isolate HPP1 from normal mucose. Using reverse transcription-PCR, HPP1 was expressed in 28 of 30 (93%) normal colonic samples but in only seven of 30 (23%) colorectal cancers (P < 0.001). The 5' region of HPP1 included a CpG island containing 49 CpG sites, of which 96% were found to be methylated by bisulfite sequencing of DNA from colonic tumor samples. By COBRA analysis, methylation was detected in six of nine (66%) adenomas, 17 of 27 (63%) hyperplastic polyps, and 46 of 55 (84%) colorectal cancers. There was an inverse relationship between methylation level and mRNA expression in cancers (r = -0.67; P < 0.001), and 5-aza-2-deoxycytidine treatment restored HPP1 expression in two colorectal cancer cell lines. In situ hybridization of HPP1 indicated that expression occurs in epithelial and stromal elements in normal mucosa but is silenced in both cell types in early colonic neoplasia. HPP1 is predicted to encode a transmembrane protein containing follistatin and epidermal growth factor-like domains. Silencing of HPP1 by methylation may increase the probability of neoplastic transformation.

Serrated route to colorectal cancer: back street or super highway?

Morphological and molecular studies are beginning to distinguish separate evolutionary pathways for colorectal cancer, The serrated pathway encompassing hyperplastic aberrant crypt foci, hyperplastic polyps. mixed polyps, and serrated adenoma is increasingly being linked with genetic alterations, including DNA methylation, DNA microsatellite instability, Ii-ras mutation, and loss of chromosome Ip, The importance of the serrated pathway has been underestimated in terms of its frequency and potential for rapid progression, Copyright (C) 2001 John Wiley & Sons, Ltd.

Hyperplastic polyposis - Association with colorectal cancer

Hyperplastic polyposis is a loosely defined syndrome initially thought not to confer a clinically important predisposition to colorectal cancer. The aim of the current study was to examine the clinical, histologic, and molecular features of a prospective series of cases meeting a strict definition of the condition. Twelve patients were identified, seven of whom had developed colorectal cancer. Most polyps were hyperplastic, but 11 patients also had polyps containing dysplasia as either serrated adenomas. mixed polyps, or traditional adenomas. The mean percentage of dysplastic polyps in patients with cancer was 35%, and in patients without cancer, 11%(p < 0.05). Microsatellite instability (MSI) was present in 3 of 47 hyperplastic polyps and two of right serrated adenomas. Kras was mutated in 8 of 47 hyperplastic polyps and two of eight serrated adenomas. No polyps showed loss of heterozygosity of chromosomes 5q, 1p, or 18q. Two of seven cancers showed a high level of MSI. It is concluded that hyperplastic polyposis is associated with a high risk of colorectal cancer. Hyperplastic polyps are the dominant type of polyp, but most cases have some dysplastic epithelium. A higher proportion of dysplastic polyps is associated with increased cancer risk. Clonal generic changes are observed in some hyperplastic polyps and serrated adenomas.

Hyperplastic polyps of the colorectum - Innocent or guilty?

Hyperplastic polyps have traditionally been regarded as nonneoplastic polyps lacking malignant potential. The demonstration of genetic alterations within these lesions indicates an underlying neoplastic cause. There is evidence that hyperplastic polyps are heterogeneous. Most are innocuous, but subsets may have malignant potential. Risk factors for neoplastic progression include multiple, large, and proximally located polyps. Aberrant methylation resulting in the silencing of cancer genes may be an important underlying mechanism, particularly in pathways progressing to tumors with DNA microsatellite instability. Lesions intermediate between hyperplastic polyp and cancer include admired polyps and serrated adenomas. Currently, pathologists have different thresholds for diagnosing serrated adenomas, including the distinction from large hyperplastic polyps. Reasons for over looking this pathway in the past may include rapid tumor progression and the fact that proximally located hyperplastic polyps may be flat and not especially numerous. Management of the serrated pathway of colorectal neoplasia may require novel approaches to screening, early detection, and prevention.

Molecular and cellular biology of pre-malignancy in the gastrointestinal tract

Important pathogenic alterations within established cancers are acquired during the premalignant stage. These genetic alterations can be grouped into specific neoplastic pathways that differ within and between anatomical sites. By understanding the mechanisms that determine the initiation and progression of each pathway, it will be possible to develop novel approaches to the diagnosis, prevention and treatment of cancer. This chapter outlines the principles underlying the molecular characterization of pre-malignant lesions, taking colorectal neoplasia as the main model.