107 resultados para S18Y polymorphism


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Ozone is a major air pollutant with adverse health effects which exhibit marked inter-individual variability. In mice, regions of genetic linkage with ozone-induced lung injury include the tumor necrosis factor-alpha (TNF), lymphotoxin-alpha (LTA), Toll-like receptor 4 (TLR4), superoxide dismutase (SOD2), and glutathione peroxidase (GPX1) genes. We genotyped polymorphisms in these genes in 51 individuals who had undergone ozone challenge. Mean change in FEV1 with ozone challenge, as a percentage of baseline, was -3% in TNF -308G/A or A/A individuals, compared with -9% in G/G individuals (p = 0.024). When considering TNF haplotypes, the smallest change in FEV1 with ozone exposure was associated with the TNF haplotype comprising LTA +252G/TNF -1031T/TNF -308A/TNF -238G. This association remained statistically significant after correction for age, sex, disease, and ozone concentration (p = 0.047). SOD2 or GPX1 genotypes were not associated with lung function, and the TLR4 polymorphism was too infrequent to analyze. The results of this study support TNF as a genetic factor for susceptibility to ozone-induced changes in lung function in humans, and has potential implications for stratifying health risks of air pollution.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A polymorphism of the dopamine transporter gene (DAT1, 10-repeat) is associated with attention-deficit hyperactivity disorder (ADHD) and has been linked to an enhanced response to methylphenidate (MPH). One aspect of the attention deficit in ADHD includes a subtle inattention to left space, resembling that seen after right cerebral hemisphere damage. Since left-sided inattention in ADHD may resolve when treated with MPH, we asked whether left-sided inattention in ADHD was related to DAT1 genotype and the therapeutic efficacy of MPH. A total of 43 ADHD children and their parents were genotyped for the DAT1 30 variable number of tandem repeats polymorphism. The children performed the Landmark Test, a well-validated measure yielding a spatial attentional asymmetry index ( leftward to rightward attentional bias). Parents rated their child's response to MPH retrospectively using a three-point scale ( no, mediocre or very good response). Additionally, parents used a symptom checklist to rate behavior while on and off medication. A within-family control design determined whether asymmetry indices predicted biased transmission of 10-repeat parental DAT1 alleles and/or response to MPH. It was found that left-sided inattention predicted transmission of the 10-repeat allele from parents to probands and was associated with the severity of ADHD symptomatology. Children rated as achieving a very good response to MPH displayed left-sided inattention, while those rated as achieving a poorer response did not. Our results suggest a subgroup of children with ADHD for whom the 10-repeat DAT1 allele is associated with left-sided inattention. MPH may be most efficacious in this group because it ameliorates a DAT1-mediated hypodopaminergic state.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Statins have been the mainstay of lipid-lowering therapy since their introduction. However, as lower LDL cholesterol targets are sought, adjunct therapies are becoming increasingly important. Few patients reach new targets with statin monotherapy. We propose that the cholestanol: cholesterol ratio can be used to guide lipid-lowering therapy and result in greater numbers of patients reaching target LDL cholesterol. By determining whether a patient is mainly a synthesizer or absorber of cholesterol, customized regimens can be used and are expected to improve patient outcomes and minimize costs of treatment. (c) 2005 Elsevier Ireland Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Epidemiologic studies have suggested that aromatic amines (and nitroaromatic hydrocarbons) may be carcinogenic for human pancreas, Pancreatic tissues from 29 organ donors (13 smokers, 16 non-smokers) were examined for their ability to metabolize aromatic amines and other carcinogens, Microsomes showed no activity for cytochrome P450 (P450) 1A2-dependent N-oxidation of 4-aminobiphenyl (ABP) or for the following activities (and associated P450s): aminopyrine N-demethylation and ethylmorphine N-demethylation (P450 3A4); ethoxyresorufin O-deethylation (P450 1A1) and pentoxyresorufin O-dealkylation (P450 2B6); p-nitrophenol hydroxylation and N-nitrosodimethylamine N-demethylation (P450 2E1); lauric acid omega-hydroxylation (P450 4A1); and 4-(methylnitrosamino)-1-(3-pyridyl-1-butanol) (NNAL) and 4-(methylnitrosamino)1-(3-pyridyl)-1-butanone (NNK) alpha-oxidation (P450 1A2, 2A6, 2D6). Antibodies were used to examine microsomal levels of P450 1A2, 2A6, 2C8/9/18/19, 2E1, 2D6, and 3A3/ 4/5/7 and epoxide hydrolase. Immunoblots detected only epoxide hydrolase at low levels; P450 levels were <1% of liver. Microsomal benzidine/prostaglandin hydroperoxidation activity was low. In pancreatic cytosols and microsomes, 4-nitrobiphenyl reductase activities were present at levels comparable to human liver. The O-acetyltransferase activity (AcCoA-dependent DNA-binding of [H-3]N-hydroxy-ABP) of pancreatic cytosols was high, about two-thirds the levels measured in human colon. Cytosols showed high activity for N-acetylation of p-aminobenzoic acid, but not of sulfamethazine, indicating that acetyltransferase-1 (NAT1) is predominantly expressed in this tissue. Cytosolic sulfotransferase was detected at low levels. Using P-32-post-labeling enhanced by butanol extraction, putative arylamine-DNA adducts were detected in most samples. Moreover, in eight of 29 DNA samples, a major adduct was observed that was chromatographically identical to the predominant ABP-DNA adduct, N-(deoxyguanosin-8-yl)-ABP. These results are consistent with a hypothesis that aromatic amines and nitroaromatic hydrocarbons may be involved in the etiology of human pancreatic cancer.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Phytophthora cinnamomi isolates collected from 1977 to 1986 and 1991 to 1993 in two regions in South Africa were analyzed using isozymes. A total of 135 isolates was analyzed for 14 enzymes representing 20 putative loci, of which four were polymorphic. This led to the identification of nine different multilocus isozyme genotypes. Both mating types of P. cinnamomi occurred commonly in the Cape region, whereas, predominantly, the A2 mating type occurred in the Mpumalanga region of South Africa. A2 mating type isolates could be resolved into seven multilocus isozyme genotypes, compared with only two multilocus isozyme genotypes for the A1 mating type isolates. Low levels of gene (0.115) and genotypic (2.4%) diversity and a low number of alleles per locus (1.43) were observed for the South African P. cinnamomi population. The genetic distance between the Cape and Mpumalanga P. cinnamomi populations was relatively low (D-m = 0.165), and no specific pattern in regional distribution of multilocus isozyme genotypes could be observed. The genetic distance between the ''old'' (isolated between 1977 and 1986) and ''new'' (isolated between 1991 and 1993) P. cinnamomi populations from the Cape was low (D-m = 0.164), indicating a stable population over time. Three of the nine multilocus isozyme genotypes were specific to the ''old'' population, and only one multilocus isozyme genotype was specific to the ''new'' population. Significant differences in allele frequencies, a high genetic distance (D-m = 0.581) between the Cape A1 and A2 mating type isolates, significant deviations from Hardy-Weinberg equilibrium, a low overall level of heterozygosity, and a high fixation index (0.71) all indicate that sexual reproduction occurs rarely, if at all, in the South African P. cinnamomi population.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Microsatellites or simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Single-locus SSR markers have been developed for a number of species, although there is a major bottleneck in developing SSR markers whereby flanking sequences must be known to design 5'-anchors for polymerase chain reaction (PCR) primers. Inter SSR (ISSR) fingerprinting was developed such that no sequence knowledge was required. Primers based on a repeat sequence, such as (CA)(n), can be made with a degenerate 3'-anchor, such as (CA)(8)RG or (AGC)(6)TY. The resultant PCR reaction amplifies the sequence between two SSRs, yielding a multilocus marker system useful for fingerprinting, diversity analysis and genome mapping. PCR products are radiolabelled with P-32 or P-33 via end-labelling or PCR incorporation, and separated on a polyacrylamide sequencing gel prior to autoradiographic visualisation. A typical reaction yields 20-100 bands per lane depending on the species and primer. We have used ISSR fingerprinting in a number of plant species, and report here some results on two important tropical species, sorghum and banana. Previous investigators have demonstrated that ISSR analysis usually detects a higher level of polymorphism than that detected with restriction fragment length polymorphism (RFLP) or random amplified polymorphic DNA (RAPD) analyses. Our data indicate that this is not a result of greater polymorphism genetically, but rather technical reasons related to the detection methodology used for ISSR analysis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Marine sponges often harbour communities of symbiotic microorganisms that fulfil necessary functions for the well-being of their hosts. Microbial communities associated with the sponge Rhopaloeides odorabile were used as bioindicators far sublethal cupric ion (Cu2+) stress. A combined strategy incorporating molecular, cultivation and electron microscopy techniques was adopted to monitor changes in microbial diversity. The total density of sponge-associated bacteria and counts of the predominant cultivated symbiont (alpha -proteobacterium strain NW001) were significantly reduced in response to Cu2+ concentrations of 1.7 mug l(-1) and above after 14 days of exposure. The number of operational taxonomic units (OTUs) detected by restriction fragment length polymorphism (RFLP) decreased by 64% in sponges exposed to 223 mug l(-1) Cu2+ for 48 h and by 46% in sponges exposed to 19.4 mug l(-1) Cu2+ for 14 days. Electron microscopy was used to identify 17 predominant bacterial morphotypes, composing 47% of the total observed cells in control sponges. A reduction In the proportion of these morphotypes to 25% of observed cells was evident in sponges exposed to a Cu2+ concentration of 19.4 mug l(-1). Although the abundance of most morphotypes decreased under Cu2+ stress, three morphotypes were not reduced in numbers and a single morphotype actually increased in abundance. Bacterial numbers, as detected using fluorescence in situ hybridization (FISH), decreased significantly after 48 h exposure to 19.4 mug l(-1) Cu2+. Archaea, which are normally prolific in R. odorabile, were not detected after exposure to a Cu2+ concentration of 19.4 mug l(-1) for 14 days, indicating that many of the microorganisms associated with R. odorabile are sensitive to free copper. Sponges exposed to a Cu2+ concentration of 223 mug l(-1) became highly necrosed after 48 h and accumulated 142 +/- 18 mg kg(-1) copper, whereas sponges exposed to 19.4 mug l(-1) Cu2+ accumulated 306 +/- 15 mg kg(-1) copper after 14 days without apoptosis or mortality. Not only do sponges have potential for monitoring elevated concentrations of heavy metals but also examining changes in their microbial symbionts is a novel and sensitive bioindicator for the assessment of pollution on important microbial communities.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We surveyed the larval habitats of member,, of the Anopheles punctulatus group of mosquitoes on Niolam (Lihir) Island. Papua New Guinea. Identification of this group was undertaken by polymerase chain reaction-restriction fragment length polymorphism analysis of the amplified internal transcribed spacer unit 2 of rDNA. because morphologic separation of member species is unreliable. The most widespread malaria vector species and their most common larval habitats identified to aid source-reduction programs for malaria control. The most ubiquitous species was An. punctulatus, followed by An. farauti no. 2. then An. farauti s.s. Anopheles punctulatus has increased relative to An.farauti s.l. since the start of development projects on Lihir Island. The most common larval habitats were shallow temporary pools with clay substrate and with plants or floatage. These habitats. mostly encountered alongside poorly drained roads, may be increased by development projects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The major proteins of baboon milk were identified as beta -lactoglobulin (beta LG), alpha -lactalbumin (alpha LA), lysozyme, lactoferrin, casein, and albumin by immobiline isoelectric focusing, SDS-PAGE, immunoblotting of gels with rabbit antisera to human alpha LA, lysozyme, and albumin and bovine beta LG and casein, and N-terminal sequencing of proteins blotted from gels. The first 30 N-terminal residues of baboon polymorphism at residue 2. The complete cDNA sequence and derived amino acid composition of beta LG were elucidated using RT-PCR amplification of poly(A)(+) mRNA purified from lactating mammary gland. Baboon beta LG identified to date. beta LG and alpha LA polymorphisms with three (A, B, and C) and two (A and B) variants, respectively, were detected by immobiline IEF, pH 4-6, of individual baboon milk samples at varying stages of lactation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fibromuscular dysplasia (FMD) is an important cause of renal artery stenosis, particularly in young females. Polymorphisms of the renin-angiotensin (RA) system have been implicated in the pathogenesis of hypertension and atherosclerotic vascular disease, and may play a role in the development of FMD. Examination of polymorphisms by PCR for angiotensin-converting enzyme (ACE) I/D, angiotensin II type 1 receptor (AT(1)R) A1166C and angiotensinogen (AGT) M235T and T174M was undertaken in 43 patients with typical multifocal renal arterial FMD (MF-FMD) and in 89 controls. The age of NIF-FMD patients at the time of diagnosis of hypertension did not differ (38.6 + 11.1 years vs 35.5 +/- 10.3 years, P = 0.12) from controls and the proportion (95% vs 86%, P = 0.14) of females was similar. Allele frequencies did not differ significantly between groups, except that MF-FMD patients had a significantly higher frequency of the ACE I allele than control subjects (0.62 vs 0.47, P = 0.026). Since the ACE I allele is associated with lower circulating ACE levels and possibly lower tissue levels of angiotensin II (Ang II), and since Ang II modulates vascular smooth muscle cell growth and synthetic activity, the I allele might predispose to defective remodelling of the arterial media, and thus to the development of MF-FMD. This contrasts with atherosclerotic renal artery stenosis, coronary stent restenosis and carotid intimal thickening, which are diseases affecting the arterial intima, and which are associated with increased frequency of the D allele.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Variation in the personality trait of neuroticism is known to be affected by genetic influences, but despite a number of association studies, the genes involved have not yet been characterized. In a recent study of platelet monoamine oxidase in 1,551 twin subjects, we found a significant association between monoamine oxidase activity and scores on the Eysenck Personality Questionnaire neuroticism scale. Further analyses presented here indicate that both neuroticism and monoamine oxidase activity are associated with variation in smoking habits, and that adjusting for the effect of smoking strengthens the association between MAO and neuroticism. Analysis of the genetic and environmental sources of covariation between neuroticism, smoking, and monoamine oxidase activity show that approximately 8% of the genetic variance in neuroticism is due to the same additive genetic effects that contribute to variation in monoamine oxidase activity, suggesting that variation in neuroticism is associated in part with aspects of serotonin metabolism. (C) 2001 Wiley-Liss, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

As a result of testing for lipid and apolipoprotein(e) (apo E) phenotype status of an indigenous Australian community, an apo E variant associated with type III hyperlipoproteinaemia has been identified. Apo E phenotype was determined by analysis of VLDL by isoelectric focusing, and genotype on DNA amplified by polymerase chain reaction, using two different restriction enzyme isotyping assays. Phenotypes and genotypes were discordant in samples from two subjects and an abnormal-sized restriction fragment was also observed in their genotyping gel patterns. DNA sequencing studies revealed this was due to a single nucleotide deletion. 3817delC, at amino acid 136 on apo E. This resulted in a new reading frame and the premature termination of the apo E protein due to a stop codon (TGA) at nucleotide 4105. The variant apo E null allele showed a recessive mode of inheritance and, in combination with the E2 allele, resulted in the type III hyperlipoproteinaemic phenotype but when inherited with the E4 allele had no marked effect on plasma lipids.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Recent advances in several experimental techniques have enabled detailed structural information to be obtained for floating (Langmuir) monolayers and Langmuir-Blodgett films. These techniques are described briefly and their application to the study of films of fatty acids and their salts is discussed. Floating monolayers on aqueous subphases have been shown to possess a complex polymorphism with phases whose structures may be compared to those of smectic mesophases. However, only those phases that exist at high surface pressures are normally used in Langmuir-Blodgett (LB) deposition. In single LB monolayers of fatty acids and fatty acid salts the acyl chains are in the all-cans conformation with their long axes normal to the substrate. The in-plane molecular packing is hexagonal with long-range bond orientational order and short-range positional order: known as the hexatic-B structure. This structure is found irrespective of the phase of the parent floating monolayer. The structures of multilayer LB films are similar to the structures of their bulk crystals, consisting of stacked bilayer lamellae. Each lamella is formed from two monolayers of fatty acid molecules or ions arranged head to head and held together by hydrogen bonding between pairs of acids or ionic bonding through the divalent cations. With acids the acyl chains are tilted with respect to the substrate normal and have a monoclinic structure, whereas the salts with divalent cations may have the chains normal to the substrate or tilted. The in-plane structures are usually centred rectangular with the chains in the trans conformation and packed in a herringbone pattern, Multilayer films of the acids show only a single-step order-disorder transition at the malting point, This temperature tends to rise as the number of layers increases. Complex changes occur when multilayer films of the salts are heated. Disorder of the chains begins at low temperatures but the arrangement of the head groups does not alter until the melting temperature is reached, Slow heating to a temperature just below the melting temperature gives, with some salts, a radical change in phase. The lamellar structure disappears and a new phase consisting of cylindrical rods lying parallel to the substrate surface and stacked in a hexagonal pattern is formed, In each rod the cations are aligned along the central axis surrounded by the disordered acyl chains. (C) 2001 Elsevier Science B,V. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Much of the individual variation in drug response is due to genetic drug metabolic polymorphisms. Clinically relevant examples include acetylator status; cytochrome P450 2D6, 2C9 and 2C19 polymorphisms; and thiopurine methyltransferase deficiency. It is important to be aware of which drugs are subject to pharmacogenetic variability. In the future, population-based pharmacogenetic testing will allow more individualized drug treatment and will avoid the current empiricism.