Reserve price commitments in auctions

It is well known that the optimal auction-one that maximizes the seller's expected revenue-can be implemented using a standard auction format with a suitably chosen reserve price. This reserve price is above the seller's value of retaining the object and the mechanism requires a commitment not to sell the object below the reserve. This commitment is what makes the reserve valuable to the seller. However, in practice, a reserve price commits the seller to sell the object if the reserve is reached, but does not commit her to withhold the object from sale if bidding falls short of the reserve. In this note we investigate whether reserve prices remain valuable for the seller when she may negotiate with the highest bidder if the reserve is not met. We show that the value of the reserve price may be completely undermined if the seller is a sufficiently weak bargainer. (c) 2004 Elsevier B.V. All rights reserved.

The selection of intended actions and the observation of others' actions: A time-resolved fMRI study

Whenever we plan, imagine, or observe an action, the motor systems that would be involved in preparing and executing that action are similarly engaged. The way in which such common motor activation is formed, however, is likely to differ depending on whether it arises from our own intentional selection of action or from the observation of another's action. In this study, we use time-resolved event-related functional MRI to tease apart neural processes specifically related to the processing of observed actions, the selection of our own intended actions, the preparation for movement, and motor response execution. Participants observed a finger gesture movement or a cue indicating they should select their own finger gesture to perform, followed by a 5-s delay period; participants then performed the observed or self-selected action. During the preparation and readiness for action, prior to initiation, we found activation in a common network of higher motor areas, including dorsal and ventral premotor areas and the pre-supplementary motor area (pre-SMA); the more caudal SMA showed greater activation during movement execution. Importantly, the route to this common motor activation differed depending on whether participants freely selected the actions to perform or whether they observed the actions performed by another person. Observation of action specifically involved activation of inferior and superior parietal regions, reflecting involvement of the dorsal visual pathway in visuomotor processing required for planning the action. In contrast, the selection of action specifically involved the dorsal lateral prefrontal and anterior cingulate cortex, reflecting the role of these prefrontal areas in attentional selection and guiding the selection of responses. (c) 2005 Elsevier Inc. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Social rules and attributions in the personnel selection interview

The study investigated the social rules applicable to selection interviews, and the attributions ions made by interviewers in response to rule-breaking behaviours by candidates. Sixty personnel specialists (31 males and 29 females) participated in the main study which examined their perceptions of social rules and attributions about rule breaking in their work experience. They listened to audiotapes of actual selection interviews, and made judgments about hireability communication competence, and specific social rules. Results indicated that interview rules could be categorized into two groups: specific interview presentation skills and general interpersonal competence. While situational attributions were more salient in explaining the breaking of general interpersonal competence rules, internal attributions (ability, effort) were more salient explanations for the breaking of more specific interview rules (with the exception of the preparation rule where lack of effort was the most likely explanation for rule breaking). Candidates previously judged as competent communicators were rated more favourably on both global and specific measures of rule-following competence, as well as on hireability. The theoretical and practical implications of combining social rules and attribution theory in the study of selection interviews are discussed.

The uncharged surface features surrounding the active site of Escherichia coli DsbA are conserved and are implicated in peptide binding

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.

Effect of body composition at selection on reproductive development in large white gilts

Fifty-four Large White gilts were used to determine the effect of body composition at selection (145 d of age) on the onset of puberty and subsequent reproductive development until 202 d of age. Gilts were assigned to one of three groups based on their backfat depth at selection: 10 to 12 mm (L), 13 to 15 mm (M), and 16 to 18 mm (F). All of the F gilts, 92% of the M gilts, and 67% of the L gilts reached puberty by slaughter at 202 d of age. Data from a subgroup (first 67% to reach puberty in each group; L = Lp, M = Mp, and F = Fp) was also used. The M (Mp) and F (Fp) gilts reached puberty at 172 d (166 d) and 170 d (166 d) of age, respectively, but the L (Lp) gilts at 184.5 d were 12 d (18 d) older than M(P < .05), Mp(P < .001), and F(P < .01), Fp (P < .001) gilts. The Lp (97.68 kg) and Mp (98.33 kg) gilts were lighter (P < .01) than Fp (108.72 kg) gilts at puberty. There were no differences (P < .05) among the L, M, and F gilts in terms of backfat depth or weight at puberty. The L (Lp) gilts had a mean of 1.16 (1.75) estrous cycles, which was lower (P < .01) than for M (Mp) and (P < .01) F (Fp) gilts, with 1.96 (2.29) and 2.25 (2.33) cycles, respectively. L (Lp) gilts had fewer (P < .05) follicles, 13.14 (12.63), than either M (Mp), 19.08 (18.71), or F (Fp), 18.25 (17.42) gilts. The number of corpora lutea was not influenced (P > .05) by grouping at selection, but Fp gilts had fewer (P < .05) corpora lutea than Mp or Fp gilts. Live weight at slaughter was not influenced (P > .10) by grouping at selection or subgrouping at puberty. The L gilts with a mean of 18.05 mm of backfat at slaughter were leaner (P < .05) than the F (21.66 mm) but not (P > .10) the M gilts (19.41 mm). Subgrouping had no effect. Fat deposition and protein deposition were higher (P < .05) in those animals that attained puberty. We conclude that the rate of fat and protein deposition seems to be one of the determinants of puberty attainment.

Conformational dynamics of thyroid hormones by variable temperature nuclear magnetic resonance: The role of side chain rotations and cisoid/transoid interconversions

H-1 NMR spectra of the thyroid hormone thyroxine recorded at low temperature and high field show splitting into two peaks of the resonance due to the H2,6 protons of the inner (tyrosyl) ring. A single resonance is observed in 600 MHz spectra at temperatures above 185 K. An analysis of the line shape as a function of temperature shows that the coalescence phenomenon is due to an exchange process with a barrier of 37 kJ mol(-1). This is identical to the barrier for coalescence of the H2',6' protons of the outer (phenolic) ring reported previously for the thyroid hormones and their analogues. It is proposed that the separate peaks at low temperature are due to resonances for H2,6 in cisoid and transoid conformers which are populated in approximately equal populations. These two peaks are averaged resonances for the individual H2 and H6 protons. Conversion of cisoid to transoid forms can occur via rotation of either the alanyl side chain or the outer ring, from one face of the inner ring to the other. It is proposed that the latter process is the one responsible for the observed coalescence phenomenon. The barrier to rotation of the alanyl side chain is greater than or equal to 37 kJ mol(-1), which is significantly larger than has previously been reported for Csp(2)-Csp(3) bonds in other Ph-CH2-X systems. The recent crystal structure of a hormone agonist bound to the ligand-binding domain of the rat thyroid hormone receptor (Wagner et al. Nature 1995, 378, 690-697) shows the transoid form to be the bound conformation. The significant energy barrier to cisoid/transoid interconversion determined in the current study combined with the tight fit of the hormone to its receptor suggests that interconversion between the forms cannot occur at the receptor site but that selection for the preferred bound form occurs from the 50% population of the transoid form in solution.

The structure of versutoxin (delta-atracotoxin-Hv1) provides insights into the binding of site 3 neurotoxins to the voltage-gated sodium channel

Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.