Residues of spinosad in the tissues of sheep after aerosol treatment of blowfly myiasis

Objective To measure the residues of spinosad and chlorhexidine in the tissues of sheep after treatment of blowfly strike. Procedure Fourteen sheep with natural myiasis and 12 with artificial infestations of Lucilia cuprina larvae had the wool removed over their infestations and were treated with an aerosol wound dressing containing spinosad and chlorhexidine. Sheep were killed up to 14 days after treatment and residues of the chemicals measured in tissues. Results Chlorhexidine was not detected in any tissue. Residues of spinosad were highest in fat, lowest in muscle and intermediate in liver and kidney. The highest residue detected was 0.2 mg/kg spinosad in perirenal fat 7 days after generous treatment of a sheep with a large fly strike. Residues of spinosad in fat peaked 3 to 7 days after treatment and 1 to 3 days after treatment in liver and kidney. Conclusion These studies present a realistic worst-case in struck sheep and at the highest dose studied, equivalent to 5.8 mg spinosad per kg body weight, the maximum residue detected of 0.2 mg/kg in peri-renal fat was 20% of the Australian maximum residue limit. Muscle, liver and kidney residues of spinosad were also below the Australian maximum residue limits at all times.

Experience-induced preference for oviposition repellents derived from a non-host plant by a specialist herbivore

Foraging adults of phytophagous insects are attracted by host-plant volatiles and supposedly repelled by volatiles from non-host plants. In behavioural control of pest insects, chemicals derived from non-host plants applied to crops are expected to repel searching adults and thereby reduce egg laying. How experience by searching adults of non-host volatiles affects their subsequent searching and oviposition behaviour has been rarely tested. In laboratory experiments, we examined the effect of experience of a non-host-plant extract on the oviposition behaviour of the diamondback moth (DBM), Plutella xylostella, a specialist herbivore of cruciferous plants. Naive ovipositing DBM females were repelled by an extract of dried leaves of Chrysanthemum morifolium, a non-host plant of DBM, but experienced females were not repelled. Instead they were attracted by host plants treated with the non-host-plant extract and laid a higher proportion of eggs on treated than on untreated host plants. Such behavioural changes induced by experience could lead to host-plant range expansion in phytophagous insects and play an important role in determining outcome for pest management of some behavioural manipulation methods.

Three-dimensional model for multi-component reactive transport with variable density groundwater flow

PHWAT is a new model that couples a geochemical reaction model (PHREEQC-2) with a density-dependent groundwater flow and solute transport model (SEAWAT) using the split-operator approach. PHWAT was developed to simulate multi-component reactive transport in variable density groundwater flow. Fluid density in PHWAT depends not on only the concentration of a single species as in SEAWAT, but also the concentrations of other dissolved chemicals that can be subject to reactive processes. Simulation results of PHWAT and PHREEQC-2 were compared in their predictions of effluent concentration from a column experiment. Both models produced identical results, showing that PHWAT has correctly coupled the sub-packages. PHWAT was then applied to the simulation of a tank experiment in which seawater intrusion was accompanied by cation exchange. The density dependence of the intrusion and the snow-plough effect in the breakthrough curves were reflected in the model simulations, which were in good agreement with the measured breakthrough data. Comparison simulations that, in turn, excluded density effects and reactions allowed us to quantify the marked effect of ignoring these processes. Next, we explored numerical issues involved in the practical application of PHWAT using the example of a dense plume flowing into a tank containing fresh water. It was shown that PHWAT could model physically unstable flow and that numerical instabilities were suppressed. Physical instability developed in the model in accordance with the increase of the modified Rayleigh number for density-dependent flow, in agreement with previous research. (c) 2004 Elsevier Ltd. All rights reserved.

The Parkes half-jansky flat-spectrum sample

We present a new sample of Parkes half-jansky flat-spectrum radio sources, having made a particular effort to find any previously unidentified sources. The sample contains 323 sources selected according to a flux limit of 0.5 Jy at 2.7 GHz, a spectral index measured between 2.7 and 5.0 GHz of alpha(2.7/5.0) > -0.5, where S(nu) proportional to nu(alpha), Galactic latitude \b\ > 20 degrees and -45 degrees < declination (B1950) < +10 degrees. The sample was selected from a region 3.90 steradians in area. We have obtained accurate radio positions for all the unresolved sources in this sample, and combined these with accurate optical positions from digitized photographic sky survey data to check all the optical identifications. We report new identifications based on R- and Kn-band imaging and new spectroscopic measurements of many of the sources. We present a catalogue of the 323 sources, of which 321 now have identified optical counterparts and 277 have measured spectral redshifts.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Drugs in the acute porphyrias - Toxicogenetic diseases

The acute Porphyrias are examples of toxico-genetic diseases and diseases genetically acquired, which show an idiosyncratic reaction to certain chemicals and drugs. Porphyrics are at risk of developing an acute attack if exposed to various precipitating factors of which drugs are the most common factor. This paper presents lists of drugs complied into those hazardous for patients with acute porphyria and those thought to be safe.

Efficacy of praziquantel against Schistosoma japonicum: field evaluation in an area with repeated chemotherapy compared with a newly identified endemic focus in Hunan, China

This study conducted in 1999/2000 was designed to evaluate the efficacy of praziquantel against Schistosoma japonicum in an area with repeated chemotherapy (Area A) compared with a newly identified endemic focus (Area B) in Hunan Province, China. The population size was 2015 and 2180 in Areas A and B, respectively, of which 1129 and 1298 subjects received stool examination. A total of 230 subjects were identified by the Kato-Katz technique (4 smears per person) as being infected with S. japonicum, 124 in Area A (prevalence 11 %) and 106 in Area B (prevalence 8.2%). They were treated with a single oral dose of praziquantel (40 mg/kg) in the non-transmission season. A follow-up stool examination was made 50 days after treatment. Among the 220 cases followed, 22 were found stool-egg-positive, with an overall cure rate of 90 %, and 99 % reduction of infection intensity (eggs per gram stool). No significant difference was found in cure rates between the 2 areas (89.7% vs 90.3%). The efficacy of the drug in the area with repeated chemotherapy was not significantly different from that in the newly identified endemic focus. This study, therefore, suggests that the efficacy of praziquantel against S. japonicum has not changed in the Dongting Lake region after more than 14 years of mass chemotherapy, and there is no evidence of tolerance or resistance of S. japonicum against praziquantel.

Bi-directional reflectance of corals

An assessment of the bi-directional reflectance distribution function (BRDF) of corals with different morphologies was undertaken using hyperspectral reflectance measurements. The highest variance in reflectance obtained at different viewing angles was found for the open branching Acropora colony, possibly attributed to branch orientation and internal shadow distribution. Spectral separation within and between features at the nominated sensor-viewing angles was greatest in the near infrared portion of the spectrum. The analysis of coral reef bi-directional reflectance properties and degree of internal shadowing holds potential for future assessment and information extraction relating to coral structural characteristics.

A formal representation of assumptions in process modelling

In this work, we present a systematic approach to the representation of modelling assumptions. Modelling assumptions form the fundamental basis for the mathematical description of a process system. These assumptions can be translated into either additional mathematical relationships or constraints between model variables, equations, balance volumes or parameters. In order to analyse the effect of modelling assumptions in a formal, rigorous way, a syntax of modelling assumptions has been defined. The smallest indivisible syntactical element, the so called assumption atom has been identified as a triplet. With this syntax a modelling assumption can be described as an elementary assumption, i.e. an assumption consisting of only an assumption atom or a composite assumption consisting of a conjunction of elementary assumptions. The above syntax of modelling assumptions enables us to represent modelling assumptions as transformations acting on the set of model equations. The notion of syntactical correctness and semantical consistency of sets of modelling assumptions is defined and necessary conditions for checking them are given. These transformations can be used in several ways and their implications can be analysed by formal methods. The modelling assumptions define model hierarchies. That is, a series of model families each belonging to a particular equivalence class. These model equivalence classes can be related to primal assumptions regarding the definition of mass, energy and momentum balance volumes and to secondary and tiertinary assumptions regarding the presence or absence and the form of mechanisms within the system. Within equivalence classes, there are many model members, these being related to algebraic model transformations for the particular model. We show how these model hierarchies are driven by the underlying assumption structure and indicate some implications on system dynamics and complexity issues. (C) 2001 Elsevier Science Ltd. All rights reserved.

Using a cartographic modeling language to manipulate spectral satellite imagery

Land related information about the Earth's surface is commonIJ found in two forms: (1) map infornlation and (2) satellite image da ta. Satellite imagery provides a good visual picture of what is on the ground but complex image processing is required to interpret features in an image scene. Increasingly, methods are being sought to integrate the knowledge embodied in mop information into the interpretation task, or, alternatively, to bypass interpretation and perform biophysical modeling directly on derived data sources. A cartographic modeling language, as a generic map analysis package, is suggested as a means to integrate geographical knowledge and imagery in a process-oriented view of the Earth. Specialized cartographic models may be developed by users, which incorporate mapping information in performing land classification. In addition, a cartographic modeling language may be enhanced with operators suited to processing remotely sensed imagery. We demonstrate the usefulness of a cartographic modeling language for pre-processing satellite imagery, and define two nerv cartographic operators that evaluate image neighborhoods as post-processing operations to interpret thematic map values. The language and operators are demonstrated with an example image classification task.

A technique for preserving pigmentation in some capsalid monogeneans for taxonomic purposes

A technique is described to preserve the pigment found in the bodies and the intestine of some brightly coloured and darkly pigmented benedeniine capsalid monogeneans. Previous studies of these pigmented capsalids have proven difficult because the pigmentation usually disappears when the worms are fixed using preservatives containing concentrations of formalin over 5% and/or ethanol, acetic acid, chromic acid, picric acid and mercuric chloride. The technique developed here uses a fixative comprising glycerol, acetone and formalin (GAF). After fixation under light coverslip compression for three minutes, specimens are transferred to absolute acetone for three minutes and cleared in a mixture of nine parts cedar wood oil and one part absolute acetone before mounting in Canada balsam. Processing must be carried out quickly, as these chemicals will cause the pigments to fade if the specimens are exposed to them for too long. Pigmented benedeniines processed using this technique retain the distribution, intensity and colour observed in live worms. The colour and distribution of pigmentation in monogeneans may be of taxonomic importance and this technique aids preparation of whole-mounts suitable for registration as type-material.