195 resultados para Natural Heritage site


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Soil erosion is a major environmental issue in Australia. It reduces land productivity and has off-site effects of decreased water quality. Broad-scale spatially distributed soil erosion estimation is essential for prioritising erosion control programs and as a component of broader assessments of natural resource condition. This paper describes spatial modelling methods and results that predict sheetwash and rill erosion over the Australian continent using the revised universal soil loss equation (RUSLE) and spatial data layers for each of the contributing environmental factors. The RUSLE has been used before in this way but here we advance the quality of estimation. We use time series of remote sensing imagery and daily rainfall to incorporate the effects of seasonally varying cover and rainfall intensity, and use new digital maps of soil and terrain properties. The results are compared with a compilation of Australian erosion plot data, revealing an acceptable consistency between predictions and observations. The modelling results show that: (1) the northern part of Australia has greater erosion potential than the south; (2) erosion potential differs significantly between summer and winter; (3) the average erosion rate is 4.1 t/ha. year over the continent and about 2.9 x 10(9) tonnes of soil is moved annually which represents 3.9% of global soil erosion from 5% of world land area; and (4) the erosion rate has increased from 4 to 33 times on average for agricultural lands compared with most natural vegetated lands.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Many drugs and chemicals found in the environment are either detoxified by N-acetyltransferase 1 (NAT1, EC 2.3.1.5) and eliminated from the body or bioactivated to metabolites that have the potential to cause toxicity and/or cancer. NAT1 activity in the body is regulated by genetic polymorphisms as well as environmental factors such as substrate-dependent down-regulation and oxidative stress. Here we report the molecular mechanism for the low protein expression from mutant NAT1 alleles that gives rise to the slow acetylator phenotype and show that a similar process accounts for enzyme down-regulation by NAT1 substrates. NAT1 allozymes NAT1 14, NAT1 15, NAT1 17, and NAT1 22 are devoid of enzyme activity and have short intracellular half-lives (similar to4 h) compared with wild-type NAT1 4 and the active allozyme NAT1 24. The inactive allozymes are unable to be acetylated by cofactor, resulting in ubiquitination and rapid degradation by the 26 S proteasome. This was confirmed by site-directed mutagenesis of the active site cysteine 68. The NAT1 substrate p-aminobenzoic acid induced ubiquitination of the usually stable NAT1 4, leading to its rapid degradation. From this study, we conclude that NAT1 exists in the cell in either a stable acetylated state or an unstable non-acetylated state and that mutations in the NAT1 gene that prevent protein acetylation produce a slow acetylator phenotype.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As larvae of marine invertebrates age, their response to settlement cues can change. This change can have significant consequences to both the ecology of these organisms, and to their response to antifouling coatings. This study examines how larval age affects the settlement response of larvae to two naturally derived settlement inhibitors, non-polar extracts from the algae Delisea pulchra and Dilophus marginatus, the former of which contains compounds that are in commercial development as antifoulants. Two species of marine invertebrates with non-feeding larvae were investigated: the bryozoans Watersipora subtorquata and Bugula neritina. Larval age strongly affected larval settlement, with older larvae settling at much higher rates than younger larvae. Despite having strong, inhibitory effects on young larvae, the non-polar extracts did not inhibit the settlement of older larvae to the same degree for both species studied. The results show that the effects of ecologically realistic settlement inhibitors are highly dependent on larval age. Given that the age of settling larvae is likely to be variable in the field, such age specific variation in settlement response of larvae may have important consequences for host-epibiont interactions in natural communities.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A conformationally biased decapeptide agonist of human C5a (C5a(65-74)Y65,F67,P69,P71,D-Ala73 or YSFKPMPLaR) was used as a functional probe of the C5a receptor (C5aR) in order to understand the conformational features in the C-terminal effector region of C5a that are important for C5aR binding and signal transduction. YSFKPMPLaR was a potent, full agonist of C5a, but at higher concentrations had a superefficacious effect compared to the natural factor. The maximal efficacy of this analogue was 216 +/- 56% that of C5a in stimulating the release of beta-glucuronidase from human neutrophils. C5aR activation and binding curves both occurred in the same concentration range with YSFKPMPLaR, characteristics not observed with natural C5a or more conformationally flexible C-terminal agonists. YSFKPMPLaR was then used as a C-terminal effector template onto which was synthesized various C5aR binding determinants from the N-terminal core domain of the natural factor. In general, the presence of N-terminal binding determinants had little effect on either potency or binding affinity when the C-terminal effector region was presented to the C5aR in this biologically active conformation. However, one peptide, C5a(12-20)-Ahx-YSFKPMPLaR, expressed a 100-fold increase in affinity for the neutrophil C5aR and a 6-fold increase in potency relative to YSFKPMPLaR. These analyses showed that the peptides used in this study have up to 25% of the potency of C5a in human fetal artery and up to 5% of the activity of C5a in the PMN enzyme release assay.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Herpesviruses, such as murine and human cytomegalovirus (MCMV and HCMV), can establish a persistent infection within the host and have diverse mechanisms as protection from host immune defences'. Several herpesvirus genes that are homologous to host immune modulators have been identified, and are implicated in viral evasion of the host immune response(2,3). The discovery of a viral major histocompatibility complex (MHC) class I homologue, encoded by HCMV(4), led to speculation that it might function as an immune modulator and disrupt presentation of peptides by MHC class I to cytotoxic T cells(5). However, there is no evidence concerning the biological significance of this gene during viral infection. Recent analysis of the MCMV genome has also demonstrated the presence of a MHC class I homologue(6). Here we show that a recombinant MCMV,in which. the gene encoding the class I homologue has been disrupted, has severely restricted replication during the acute stage of infection compared with wild-type MCMV, We demonstrate by in vivo depletion studies that natural killer (NK) cells are responsible for the attenuated phenotype of the mutant. Thus the viral MHC dass I homologue contributes to immune evasion through interference with NK cell-mediated clearance.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.

Relevância:

20.00% 20.00%

Publicador: