115 resultados para Locus Flv


Relevância:

10.00% 10.00%

Publicador:

Resumo:

EDD (E3 isolated by differential display), located at chromosome 8q22.3, is the human orthologue of the Drosophila melanogaster tumour suppressor gene 'hyperplastic discs' and encodes a HECT domain E3 ubiquitin protein-ligase. To investigate the possible involvement of EDD in human cancer, several cancers from diverse tissue sites were analysed for allelic gain or loss (allelic imbalance, AI) at the EDD locus using an EDD-specific microsatellite, CEDD, and other polymorphic microsatellites mapped in the vicinity of the 8q22.3 locus. Of 143 cancers studied, 38 had AI at CEDD (42% of 90 informative cases). In 14 of these cases, discrete regions of imbalance encompassing 8q22.3 were present, while the remainder had more extensive 8q aberrations. AI of CEDD was most frequent in ovarian cancer (22/47 informative cases, 47%), particularly in the serous subtype (16/22, 73%), but was rare in benign and borderline ovarian tumours. AI was also common in breast cancer (31%), hepatocellular carcinoma (46%), squamous cell carcinoma of the tongue (50%) and metastatic melanoma (18%). AI is likely to represent amplification of the EDD gene locus rather than loss of heterozygosity, as quantitative RT-PCR and immunohistochemistry showed that EDD mRNA and protein are frequently overexpressed in breast and ovarian cancers, while among breast cancer cell lines EDD overexpression and increased gene copy number were correlated. These results demonstrate that AI at the EDD locus is common in a diversity of carcinomas and that the EDD gene is frequently overexpressed in breast and ovarian cancer, implying a potential role in cancer progression.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Restricted cochlear lesions in adult animals result in plastic changes in the representation of the lesioned cochlea, and thus in the frequency map, in the contralateral auditory cortex and thalamus. To examine the contribution of subthalamic changes to this reorganization, the effects of unilateral mechanical cochlear lesions on the frequency organization of the central nucleus of the inferior colliculus (ICC) were examined in adult cats. Lesions typically resulted in a broad high-frequency hearing loss extending from a frequency in the range 15-22 kHz. After recovery periods of 2.5-18 months, the frequency organization of ICC contralateral to the lesioned cochlea was determined separately for the onset and late components of multiunit responses to tone-burst stimuli. For the late response component in all but one penetration through the ICC, and for the onset response component in more than half of the penetrations, changes in frequency organization in the lesion projection zone were explicable as the residue of prelesion responses. In half of the penetrations exhibiting nonresidue type changes in onset-response frequency organization, the changes appeared to reflect the unmasking of normally inhibited inputs. In the other half it was unclear whether the changes reflected unmasking or a dynamic process of reorganization. Thus, most of the observed changes were explicable as passive consequences of the lesion, and there was limited evidence for plasticity in the ICC. The implications of the data with respect to the primary locus of the changes and to the manner in which they contribute to thalamocortical reorganization are considered. (C) 2003 Wiley-Liss, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Diverse self-incompatibility (SI) mechanisms permit flowering plants to inhibit fertilization by pollen that express specificities in common with the pistil. Characteristic of at least two model systems is greatly reduced recombination across large genomic tracts surrounding the S-locus, which regulates SI. In three angiosperm families, including the Solanaceae, the gene that controls the expression of gametophytic SI in the pistil encodes a ribonuclease (S-RNase). The gene that controls pollen SI expression is currently unknown, although several candidates have recently been proposed. Although each candidate shows a high level of polymorphism and complete allelic disequilibrium with the S-RNase gene, such properties may merely reflect tight linkage to the S-locus, irrespective of any functional role in SI. We analyzed the magnitude and nature of nucleotide variation, with the objective of distinguishing likely candidates for regulators of SI from other genes embedded in the S-locus region. We studied the S-RNase gene of the Solanaceae and 48A, a candidate for the pollen gene in this system, and we also conducted a parallel analysis of the regulators of sporophytic SI in Brassica, a system in which both the pistil and pollen genes are known. Although the pattern of variation shown by the pollen gene of the Brassica system is consistent with its role as a determinant of pollen specificity, that of 48A departs from expectation. Our analysis further suggests that recombination between 48A and S-RNase may have occurred during the interval spanned by the gene genealogy, another indication that 48A may not regulate SI expression in pollen.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background: Familial partial epilepsy with variable foci (FPEVF) is an autosomal dominant syndrome characterized by partial seizures originating from different brain regions in different family members in the absence of detectable structural abnormalities. A gene for FPEVF was mapped to chromosome 22q12 in two distantly related French-Canadian families. Methods: We describe the clinical features and performed a linkage analysis in a Spanish kindred and in a third French-Canadian family distantly related to the original pedigrees. Results: Onset of seizures was typically in middle childhood, and attacks were usually easy to control. Seizure semiology varied among family members but was constant for each individual. In some, a pattern of nocturnal frontal lobe seizures led to consideration of the diagnosis of autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE). The Spanish family was mapped to chromosome 22q (multipoint lod score, 3.4), and the new French-Canadian family had a multipoint lod score of 2.97 and shared the haplotype of the original French-Canadian families. Conclusions: Identification of the various forms of familial partial epilepsy is challenging, particularly in small families, in which insufficient individuals exist to identify a specific pattern. We provide clinical guidelines for this task, which will eventually be supplanted by specific molecular diagnosis. We confirmed linkage of FPEVF to chromosome 22q 12 and redefined the region to a 5.2-Mb segment of DNA.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Progressive myoclonus epilepsy (PME) has a number of causes, of which Unverricht-Lundborg disease (ULD) is the most common. ULD has previously been mapped to a locus on chromosome 21 (EPM1). Subsequently, mutations in the cystatin B gene have been found in most cases. In the present work we identified an inbred Arab family with a clinical pattern compatible with ULD, but mutations in the cystatin B gene were absent. We sought to characterize the clinical and molecular features of the disorder. The family was studied by multiple field trips to their town to clarify details of the complex consanguineous relationships and to personally examine the family. DNA was collected for subsequent molecular analyses from 21 individuals. A genome-wide screen was performed using 811 microsatellite markers. Homozygosity mapping was used to identify loci of interest. There were eight affected individuals. Clinical onset was at 7.3 +/- 1.5 years with myoclonic or tonic-clonic seizures. All had myoclonus that progressed in severity over time and seven had tonic-clonic seizures. Ataxia, in addition to myoclonus, occurred in all. Detailed cognitive assessment was not possible, but there was no significant progressive dementia. There was intrafamily variation in severity; three required wheelchairs in adult life; the others could walk unaided. MRI, muscle and skin biopsies on one individual were unremarkable. We mapped the family to a 15-megabase region at the pericentromeric region of chromosome 12 with a maximum lod score of 6.32. Although the phenotype of individual subjects was typical of ULD, the mean age of onset (7.3 years versus 11 years for ULD) was younger. The locus on chromosome 12 does not contain genes for any other form of PME, nor does it have genes known to be related to cystatin B. This represents a new form of PME and we have designated the locus as EPM1B.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The genetic mechanisms responsible for the formation of adrenocortical adenomas which autonomously produce aldosterone are largely unknown, The adrenal renin-angiotensin system has been implicated in the pathophysiology of these tumours, Angiotensin-converting enzyme (ACE) catalyses the generation of angiotensin II, and the insertion/deletion (I/D) polymorphism of the ACE gene regulates up to 50% of plasma and cellular ACE variability in humans. We therefore examined the genotypic and allelic frequency distributions of the ACE gene I/D polymorphism in 55 patients with aldosterone-producing adenoma, APA, (angiotensin-unresponsive APA n = 28, angiotensin-responsive APA n = 27), and 80 control subjects with no family history of hypertension, We also compared the ACE gene I/D polymorphism allelic pattern in matched tumour and peripheral blood DNA in the 55 patients with APA, The frequency of the D allele was 0.518 and 0.512 and the I allele was 0.482 and 0.488 in the APA and control subjects respectively, Genotypic and allelic frequency analysis found no significant differences between the groups, Examination of the matched tumour and peripheral blood DNA samples revealed the loss of the insertion allele in four of the 25 patients who were heterozygous for the ACE I/D genotype. The I/D polymorphism of the ACE gene does not appear to contribute to the biochemical and phenotypic characteristics of APA, however, the deletion of the insertion allele of the ACE gene I/D polymorphism in 16% of aldosterone-producing adenomas may represent the loss of a tumour suppressor gene/s or other genes on chromosome 17q which may contribute to tumorigenesis in APA.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Tissue damage in the kidney and brain after systemic infection with Candida albicans was examined in recombinant inbred strains (AKXL) derived from AKR and C57/L progenitors. Nine of the 15 strains showed mild (C57/L-like) tissue damage. Of the remainder, two strains developed lesions comparable to the AKR parental strain, whereas four exhibited a much move severe pattern of tissue damage. This was characterized by pronounced mycelial growth in the brain, and gross oedema of the kidney, with extensive fungal colonization and marked tissue destruction. The presence of the null allele of the haemolytic complement gene (Hc) may be necessary but not sufficient, for the expression of the very severe lesions. The results were interpreted as reflecting the actions of two independent genes, which have been designated Carg1 and Carg2 (Candida albicans resistance genes 1 and 2). (C) 1997 Academic Press Limited.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Phytophthora cinnamomi isolates collected from 1977 to 1986 and 1991 to 1993 in two regions in South Africa were analyzed using isozymes. A total of 135 isolates was analyzed for 14 enzymes representing 20 putative loci, of which four were polymorphic. This led to the identification of nine different multilocus isozyme genotypes. Both mating types of P. cinnamomi occurred commonly in the Cape region, whereas, predominantly, the A2 mating type occurred in the Mpumalanga region of South Africa. A2 mating type isolates could be resolved into seven multilocus isozyme genotypes, compared with only two multilocus isozyme genotypes for the A1 mating type isolates. Low levels of gene (0.115) and genotypic (2.4%) diversity and a low number of alleles per locus (1.43) were observed for the South African P. cinnamomi population. The genetic distance between the Cape and Mpumalanga P. cinnamomi populations was relatively low (D-m = 0.165), and no specific pattern in regional distribution of multilocus isozyme genotypes could be observed. The genetic distance between the ''old'' (isolated between 1977 and 1986) and ''new'' (isolated between 1991 and 1993) P. cinnamomi populations from the Cape was low (D-m = 0.164), indicating a stable population over time. Three of the nine multilocus isozyme genotypes were specific to the ''old'' population, and only one multilocus isozyme genotype was specific to the ''new'' population. Significant differences in allele frequencies, a high genetic distance (D-m = 0.581) between the Cape A1 and A2 mating type isolates, significant deviations from Hardy-Weinberg equilibrium, a low overall level of heterozygosity, and a high fixation index (0.71) all indicate that sexual reproduction occurs rarely, if at all, in the South African P. cinnamomi population.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Microsatellites or simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Single-locus SSR markers have been developed for a number of species, although there is a major bottleneck in developing SSR markers whereby flanking sequences must be known to design 5'-anchors for polymerase chain reaction (PCR) primers. Inter SSR (ISSR) fingerprinting was developed such that no sequence knowledge was required. Primers based on a repeat sequence, such as (CA)(n), can be made with a degenerate 3'-anchor, such as (CA)(8)RG or (AGC)(6)TY. The resultant PCR reaction amplifies the sequence between two SSRs, yielding a multilocus marker system useful for fingerprinting, diversity analysis and genome mapping. PCR products are radiolabelled with P-32 or P-33 via end-labelling or PCR incorporation, and separated on a polyacrylamide sequencing gel prior to autoradiographic visualisation. A typical reaction yields 20-100 bands per lane depending on the species and primer. We have used ISSR fingerprinting in a number of plant species, and report here some results on two important tropical species, sorghum and banana. Previous investigators have demonstrated that ISSR analysis usually detects a higher level of polymorphism than that detected with restriction fragment length polymorphism (RFLP) or random amplified polymorphic DNA (RAPD) analyses. Our data indicate that this is not a result of greater polymorphism genetically, but rather technical reasons related to the detection methodology used for ISSR analysis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Early studies of changes in mucin expression in disorders of the gastrointestinal tract focused on alterations in the carbohydrate chain. This review briefly considers the various mechanisms by which such alterations may come about: (a) normal variation, (b) sialic acid alterations, (c) defective assembly of carbohydrate side-chains, (d) changed expression of core proteins and (e) epithelial metaplasia. The availability of monoclonal antibodies to mucin core proteins adds a new dimension to mucin histochemistry. It is now possible to offer explanations for traditional mucin histochemical findings on the basis of lineage-specific patterns of mucin core protein expression. Changes in core protein expression are described in inflammatory, metaplastic and neoplastic disorders of the gastrointestinal tract. The possibility that mucin change could be important in the aetiology of some diseases such as ulcerative colitis and H. pylori gastritis is considered. It is more probable, however, that changes in mucin expression are secondary to reprogramming of cellular differentiation and altered cell turnover. As such they may serve as markers to explain pathogenesis and provide novel diagnostic and prognostic information.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The majority of small-cell lung cancers (SCLCs) express p16 but not pRb, Given our previous study showing loss of pRb in Merkel cell carcinoma (MCC)/neuroendocrine carcinoma of the skin and the clinicopathological similarities between SCLC acid MCC, we wished to determine if this was also the case in MCC, Twenty-nine MCC specimens from 23 patients were examined for deletions at 10 loci on 9p and I on 9p. No loss of heterozygosity (LO H) was peen in 9 patients including 2 for which tumour and cell line DNAs were examined. Four patients had LOH for all informative loci on 9p, Ten tumours showed more limited regions of loss on 9p, and from these 2 common regions of deletion were determined, Half of all informative cases had LOH at D95168, the most telomeric marker examined, and 3 specimens showed loss of only D9S168, A second region (InFNA-D9S126) showed L0H in 10(44%) cases, and case MCC26 showed LOH for only D9S126, implicating genes centromeric of the CDKN2A locus. No mutations in the coding regions of p16 were seen in 7 cell lines tested, and reactivity to anti-p16 antibody was seen in all Il tumour specimens examined and in 6 of 7 cell lines from 6 patients. Furthermore, all cell lines examined reacted with anti-p 14' antibody, These results suggest that neither transcript of the CDKN2A locus is the target of deletions on 9p in MCC and imply the existence of tumour-suppressor genes mapping both centromeric and telomeric of this locus. (C) 2001 Wiley-Liss, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study examined if brain pathways in morphine-dependent rats are activated by opioid withdrawal precipitated outside the central nervous system. Withdrawal precipitated with a peripherally acting quaternary opioid antagonist (naloxone methiodide) increased Fos expression but caused a more restricted pattern of neuronal activation than systemic withdrawal (precipitated with naloxone which enters the brain). There was no effect on locus coeruleus and significantly smaller increases in Fos neurons were produced in most other areas. However in the ventrolateral medulla (A1/C1 catecholamine neurons), nucleus of the solitary tract (A2/C2 catecholamine neurons), lateral parabrachial nucleus, supramamillary nucleus, bed nucleus of the stria terminalis. accumbens core and medial prefrontal cortex no differences in the withdrawal treatments were detected. We have shown that peripheral opioid withdrawal can affect central nervous system pathways. Crown Copyright (C) 2001 Published by Elsevier Science Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We tested the hypothesis that X-linked genes determining stature which are subject to skewed or non-random X-inactivation can account for discordance in height in monozygotic female twins. Height discordant female monozygotic adult twins (20 pairs) were identified from the Australian Twin Registry, employing the selection criteria of proven monozygosity and a measured height discordance of at least 5 cm. Differential X-inactivation was examined in genomic DNA extracted from peripheral lymphocytes by estimating differential methylation of alleles at the polymorphic CAG triplet repeat of the Androgen receptor gene (XAR). There were 17/20 MZ pairs heterozygous at this locus and informative for analysis. Of these, 10/17 both had random X-inactivation, 5/17 showed identical X-inactivation patterns of non random inactivation and 2/17 (12%) showed discordant X-inactivation. There was no relationship between inactivation patterns and self-report chorionicity. We conclude that non-random X-inactivation does not appear to be a major contributor to intra-pair height discordance in female MZ twins.