Identification of causal relationships among traits related to drought resistance in Stylosanthes scabra using QTL analysis

Previous studies have shown that a negative relationship exists between transpiration efficiency (TE) and carbon isotope discrimination (Delta) and between TE and specific leaf area (SLA) in Stylosanthes scabra, A glasshouse experiment was conducted to confirm these relationships in an F-2 population and to study the causal nature of these relationships through quantitative trait loci (QTL) analysis, One hundred and twenty F-2 genotypes from a cross between two genotypes within S. scabra were used. Three replications for each genotype were maintained through vegetative propagation, Water stress was imposed by maintaining plants at 40% of field capacity for about 45 d. To facilitate QTL analysis, a genetic linkage map consisting of 151 RAPD markers was developed, Results from this study show that Delta was significantly and negatively correlated with TE and biomass production. Similarly, SLA showed significant negative correlation with TE and biomass production, Most of the QTL for TE and Delta were present on linkage groups 5 and 11. Similarly, QTL for SLA, transpiration and biomass productivity traits were clustered on linkage groups 13 and 24, One unlinked marker was also associated with these traits, There were several markers coincident between different traits, At all the coincident QTL, the direction of QTL effects was consistent with phenotypic data, At the coincident markers between TE and Delta, high alleles of TE were associated with low alleles of Delta. Similarly, low alleles of SLA were associated with high alleles of biomass productivity traits and transpiration. At the coincident markers between trans-4-hydroxy-N-methyl proline (MHP) and relative water content (RWC), low alleles of MHP were associated with high alleles of RWC, This study suggests the causal nature of the relationship between TE and Delta. Phenotypic data and QTL, data show that SLA was more closely associated with biomass production than with TE, This study also shows that a cause-effect relationship may exist between SLA and biomass production.

Inheritance and mapping of 11 avirulence genes in Phytophthora sojae

Two new crosses involving four races (races 7, 16, 17, and 25) of the soybean root and stem rot pathogen Phytophthora sojae were established (7/16 cross; 17/25 cross). An F-2 Population derived from each cross was used to determine the genetic basis of avirulence towards 11 different resistance genes in soybean. Avirulence was found to be dominant and determined by a single locus for Avr1b, 1d, 1k, 3b, 4, and 6, as expected for a simple gene-for-gene model. We also observed several cases of segregation, inconsistent with a single dominant gene being solely responsible for avirulence, which suggests that the genetic background of the different crosses can affect avirulence. Avr4 and 6 cosegregated in both the 7/16 and 17/25 crosses and, in the 7/16 cross, Avr1b and 1k were closely linked. Information from segregating RAPD, RFLP, and AFLP markers screened on F-2 progeny from the two new crosses and two crosses described previously (a total of 212 F-2 individuals, 53 from each cross) were used to construct an integrated genetic linkage map of P. sojae. This revised genetic linkage map consists of 386 markers comprising 35 RFLP, 236 RAPD, and 105 AFLP markers, as well as 10 avirulence genes. The map is composed of 21 major linkage groups and seven minor linkage groups covering a total map distance of 1640.4 cM. (C) 2002 Elsevier Science (USA). All rights reserved.

Cytokine-related genes identified from the RIKEN full-length mouse cDNA data set

To identify novel cytokine-related genes, we searched the set of 60,770 annotated RIKEN mouse cDNA clones (FANTOM2 clones), using keywords such as cytokine itself or cytokine names (such as interferon, interleukin, epidermal growth factor, fibroblast growth factor, and transforming growth factor). This search produced 108 known cytokines and cytokine-related products such as cytokine receptors, cytokine-associated genes, or their products (enhancers, accessory proteins, cytokine-induced genes). We found 15 clusters of FANTOM2 clones that are candidates for novel cytokine-related genes. These encoded products with strong sequence similarity to guanylate-binding protein (GBP-5), interleukin-1 receptor-associated kinase 2 (IRAK-2), interleukin 20 receptor alpha isoform 3, a member of the interferon-inducible proteins of the Ifi 200 cluster, four members of the membrane-associated family 1-8 of interferon-inducible proteins, one p27-like protein, and a hypothetical protein containing a Toll/Interleukin receptor domain. All four clones representing novel candidates of gene products from the family contain a novel highly conserved cross-species domain. Clones similar to growth factor-related products included transforming growth factor beta-inducible early growth response protein 2 (TIEG-2), TGFbeta-induced factor 2, integrin beta-like 1, latent TGF-binding protein 4S, and FGF receptor 4B. We performed a detailed sequence analysis of the candidate novel genes to elucidate their likely functional properties.

Identification of novel "pathologs" (human disease-related gene candidates) from the RIKEN full-length mouse cDNA data set

The majority of common diseases such as cancer, allergy, diabetes, or heart disease are characterized by complex genetic traits, in which genetic and environmental components contribute to disease susceptibility. Our knowledge of the genetic factors underlying most of such diseases is limited. A major goal in the post-genomic era is to identify and characterize disease susceptibility genes and to use this knowledge for disease treatment and prevention. More than 500 genes are conserved across the invertebrate and vertebrate genomes. Because of gene conservation, various organisms including yeast, fruitfly, zebrafish, rat, and mouse have been used as genetic models.

Coupling between replication and packaging of flavivirus RNA: Evidence derived from the use of DNA-based full-length cDNA clones of kunjin virus

In order to study whether flavivirus RNA packaging is dependent on RNA replication, we generated two DNA-based Kunjin virus constructs, pKUN1 and pKUN1dGDD, allowing continuous production of replicating (wild-type) and nonreplicating (with a deletion of the NS5 gene RNA-polymerase motif GDD) full-length Kunjin virus RNAs, respectively, via nuclear transcription by cellular RNA polymerase II. As expected, transfection of pKUN1 plasmid DNA into BHK cells resulted in the recovery of secreted infectious Kunjin virions. Transfection of pKUN1dGDD DNA into BHK cells, however, did not result in the recovery of any secreted virus particles containing encapsidated dGDD RNA, despite an apparent accumulation of this RNA in cells demonstrated by Northern blot analysis and its efficient translation demonstrated by detection of correctly processed labeled structural proteins (at least prM and E) both in cells and in the culture fluid using coimmunoprecipitation analysis with anti-E antibodies. In contrast, when dGDD RNA was produced even in much smaller amounts in PKUN1dGDD DNA-transfected repBHK cells (where it was replicated via complementation), it was packaged into secreted virus particles, Thus, packaging of defective Kunjin virus RNA could occur only when it was replicated. Our results with genome-length Kunjin virus RNA and the results with poliovirus replicon RNA (C, I. Nugent et al,, J, Virol, 73:427-435, 1999), both demonstrating the necessity for the RNA to be replicated before it can be packaged, strongly suggest the existence of a common mechanism for minimizing amplification and transmission of defective RNAs among the quasispecies in positive-strand RNA viruses, This mechanism may thus help alleviate the high-copy error rate of RNA-dependent RNA polymerases.

Functional annotation of a full-length mouse cDNA collection

The RIKEN Mouse Gene Encyclopaedia Project, a systematic approach to determining the full coding potential of the mouse genome, involves collection and sequencing of full-length complementary DNAs and physical mapping of the corresponding genes to the mouse genome. We organized an international functional annotation meeting (FANTOM) to annotate the first 21,076 cDNAs to be analysed in this project. Here we describe the first RIKEN clone collection, which is one of the largest described for any organism. Analysis of these cDNAs extends known gene families and identifies new ones.

Targeting a complex transcriptome: The construction of the mouse full-length cDNA encyclopedia

We report the construction of the mouse full-length cDNA encyclopedia, the most extensive view of a complex transcriptome, on the basis of preparing and sequencing 246 libraries. Before cloning, cDNAs were enriched in full-length by Cap-Trapper, and in most cases, aggressively subtracted/normalized. We have produced 1,442,236 successful 3'-end sequences clustered into 171,144 groups, from which 60,770 clones were fully sequenced cDNAs annotated in the FANTOM-2 annotation. We have also produced 547,149 5' end reads, which clustered into 124,258 groups. Altogether, these cDNAs were further grouped in 70,000 transcriptional units (TU), which represent the best coverage of a transcriptome so far. By monitoring the extent of normalization/subtraction, we define the tentative equivalent coverage (TEC), which was estimated to be equivalent to >12,000,000 ESTs derived from standard libraries. High coverage explains discrepancies between the very large. numbers of clusters (and TUs) of this project, which also include non-protein-coding RNAs, and the lower gene number estimation of genome annotations. Altogether, S'-end clusters identify regions that are potential promoters for 8637 known genes and S'-end clusters suggest the presence of almost 63,000 transcriptional starting points. An estimate of the frequency of polyadenylation signals suggests that at least half of the singletons in the EST set represent real mRNAs. Clones accounting for about half of the predicted TUs await further sequencing. The continued high-discovery rate suggests that the task of transcriptome discovery is not yet complete.

Identification of putative noncoding RNAs among the RIKEN mouse full-length cDNA collection

With the sequencing and annotation of genomes and transcriptomes of several eukaryotes, the importance of noncoding RNA (ncRNA)-RNA molecules that are not translated to protein products-has become more evident. A subclass of ncRNA transcripts are encoded by highly regulated, multi-exon, transcriptional units, are processed like typical protein-coding mRNAs and are increasingly implicated in regulation of many cellular functions in eukaryotes. This study describes the identification of candidate functional ncRNAs from among the RIKEN mouse full-length cDNA collection, which contains 60,770 sequences, by using a systematic computational filtering approach. We initially searched for previously reported ncRNAs and found nine murine ncRNAs and homologs of several previously described nonmouse ncRNAs. Through our computational approach to filter artifact-free clones that lack protein coding potential, we extracted 4280 transcripts as the largest-candidate set. Many clones in the set had EST hits, potential CpG islands surrounding the transcription start sites, and homologies with the human genome. This implies that many candidates are indeed transcribed in a regulated manner. Our results demonstrate that ncRNAs are a major functional subclass of processed transcripts in mammals.

Increased expression of mitochondrial genes in human alcoholic brain revealed by differential display

Polymerase chain reaction (PCR)-based differential display was used to screen for alterations in gene expression in the mesolimbic system of the human alcoholic brain. Total RNA was extracted from the nucleus accumbens of five alcoholic and five control brains. A selected subpopulation of mRNA was reverse-transcribed to cDNA and amplified by PCR. A differentially expressed cDNA fragment was recovered, cloned, and sequenced. Full sequence analysis of this 467 bp fragment revealed 98.2% homology with the human mitochondrial 12S rRNA gene. Dot-blot analysis showed increased expression of this gem in nucleus accumbens and hippocampus, but not in the superior frontal cortex, primary motor cortex, caudate, and pallidus/putamen In a total of eight human alcoholic brains, compared with seven control brains. A similar increased expression was observed by dot-blot analysis, using RNA from the cerebral cortex of rats chronically treated with alcohol vapor. Hybridization of a 16S rRNA oligonucleotide probe indicated that the expression of both rRNAs genes was significantly increased in nucleus accumbens. These results indicate that chronic alcohol consumption induces alteration in expression of mitochondrial genes in selected brain regions. The altered gene expression may reflect mitochondrial dysfunction In the alcohol-affected brain.

Molecular characterization of Drosophila C virus isolates

Reverse transcription coupled with polymerase chain reaction and restriction enzyme analysis was used to characterize 12 Drosophila C virus isolates from geographically different regions. A 1.2-kb fragment was amplified from cDNA and profiles from digestion with 20 restriction enzymes were generated. Analysis of the restriction fragment data gave estimates of nucleotide divergence of 0-10% between isolates. The isolates were grouped on the basis of genetic distance estimates derived from the restriction data. For the isolates from which a single genotype could be purified, a geographical pattern in the distribution of viral genotypes was identified. The 4 Moroccan isolates were very closely related to each other, differing in only 1 restriction profile. The 2 Australian isolates were each other's closest relatives, as were the 2 isolates first recovered in France. The PCR-RFLP technique used in this study has provided us with a simple procedure which can be used to characterize DCV isolates. A single enzyme, Tag I, generated 5 distinct and diagnostic restriction fragment patterns, which allowed easy assignment of isolates to one of the five viral genotypes identified in this study. (C) 1999 Academic Press.

Identification of "pathologs" (disease-related genes) from the RIKEN mouse cDNA dataset using human curation plus FACTS, a new biological information extraction system

Background: A major goal in the post-genomic era is to identify and characterise disease susceptibility genes and to apply this knowledge to disease prevention and treatment. Rodents and humans have remarkably similar genomes and share closely related biochemical, physiological and pathological pathways. In this work we utilised the latest information on the mouse transcriptome as revealed by the RIKEN FANTOM2 project to identify novel human disease-related candidate genes. We define a new term patholog to mean a homolog of a human disease-related gene encoding a product ( transcript, anti-sense or protein) potentially relevant to disease. Rather than just focus on Mendelian inheritance, we applied the analysis to all potential pathologs regardless of their inheritance pattern. Results: Bioinformatic analysis and human curation of 60,770 RIKEN full-length mouse cDNA clones produced 2,578 sequences that showed similarity ( 70 - 85% identity) to known human-disease genes. Using a newly developed biological information extraction and annotation tool ( FACTS) in parallel with human expert analysis of 17,051 MEDLINE scientific abstracts we identified 182 novel potential pathologs. Of these, 36 were identified by computational tools only, 49 by human expert analysis only and 97 by both methods. These pathologs were related to neoplastic ( 53%), hereditary ( 24%), immunological ( 5%), cardio-vascular (4%), or other (14%), disorders. Conclusions: Large scale genome projects continue to produce a vast amount of data with potential application to the study of human disease. For this potential to be realised we need intelligent strategies for data categorisation and the ability to link sequence data with relevant literature. This paper demonstrates the power of combining human expert annotation with FACTS, a newly developed bioinformatics tool, to identify novel pathologs from within large-scale mouse transcript datasets.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Insulin-like growth factor 2 cDNA cloning and ontogeny of gene expression in the liver of the marsupial brushtail possum (Trichosurus vulpecula)

The cDNA sequence for insulin-like growth factor 2 (IGF-2) was determined from the liver of the marsupial brushtail possum (Trichosurus vulpecula) using reverse transcription followed by polymerase chain reaction (RT-PCR) with gene-specific primers. The 359 bp of possum sequence encompassed the mature peptide, 27 bp of the signal peptide, and 125 bp of the E-peptide. Alignment of the deduced amino acid sequence with those from other species indicated that the mature peptide was 71 amino acids in length, 4 amino acids longer than most other mammals. At both the nucleotide and amino acid levels there was a high degree of sequence identity with IGF-2 from other mammalian and nonmammalian species. Amino acid identity ranged from 94.4% with a variant form of human IGF-2 to 80.3% with zebrafinch IGF-2. Northern analysis revealed that radiolabeled possum IGF-2, cDNA hybridized to multiple transcripts in the liver of both adult possums and 150-day-old pouch young and that the overall level of expression was greater in pouch young. Semiquantitative RT-PCR with total RNA from liver samples of pouch young aged 12 to 150 days postpartum and adults confirmed that IGF-2 gene expression was two to three times more abundant in pouch young than in adults but there was no significant change in the level of expression during pouch life. Unlike other mammalian species, in which there is a decline in levels of liver IGF-2 gene expression around the time of birth, levels in the marsupial brushtail possum remain elevated for at least 150 days after birth. This suggests that the decline in liver IGF-2 expression in marsupials and eutherians occurs at a similar stage of development and may reflect a role for this growth factor during the postnatal growth and development of the marsupial, (C) 2001 Academic Press.

Identification of an apolipoprotein(e) variant associated with type III hyperlipoproteinaemia in an indigenous Australian

As a result of testing for lipid and apolipoprotein(e) (apo E) phenotype status of an indigenous Australian community, an apo E variant associated with type III hyperlipoproteinaemia has been identified. Apo E phenotype was determined by analysis of VLDL by isoelectric focusing, and genotype on DNA amplified by polymerase chain reaction, using two different restriction enzyme isotyping assays. Phenotypes and genotypes were discordant in samples from two subjects and an abnormal-sized restriction fragment was also observed in their genotyping gel patterns. DNA sequencing studies revealed this was due to a single nucleotide deletion. 3817delC, at amino acid 136 on apo E. This resulted in a new reading frame and the premature termination of the apo E protein due to a stop codon (TGA) at nucleotide 4105. The variant apo E null allele showed a recessive mode of inheritance and, in combination with the E2 allele, resulted in the type III hyperlipoproteinaemic phenotype but when inherited with the E4 allele had no marked effect on plasma lipids.

Transpecific microsatellites for hard pines M. Shepherd, M. Cross, T. Maguire, M. Dieters, C. Williams, R. Henry

Microsatellites are difficult to recover from large plant genomes so cross-specific utilisation is an important source of markers. Fifty micro satellites were tested for cross-specific amplification and polymorphism to two New World hard pine species, slash pine (Pinus elliottii var. elliottii) and Caribbean pine (R caribaea var. hondurensis). Twenty-nine (58%) markers amplified in both hard pine species, and 23 of these 29 were polymorphic. Soft pine (subgenus Strobus) microsatellite markers did amplify, but none were polymorphic. Pinus elliottii var. elliottii and R caribaea var. hondurensis showed mutational changes in the flanking regions and the repeat motif that were informative for Pinus spp. phylogenetic relationships. Most allele length variation could be attributed to variability in repeat unit number. There was no evidence for ascertainment bias.