Functional analysis, using in vitro mutagenesis, of amino acids located in the phenylalanine hydroxylase active site

The 3-dimensionaI structure determination of rat phenylalanine hydroxylase (PAH) has identified potentially important amino acids lining the active site cleft with the majority of these having hydrophobic side-chains including several with aromatic side chains. Here we have analyzed the effect on rat PAH enzyme kinetics of in vitro mutagenesis of a number of these amino acids lining the PAH active site. Mutation of F299, Y324, F331, and Y343 caused a significant decrease in enzyme activity but no change in the K-m for substrate or cofactor. me conclude that these aromatic residues are essential for activity but are not significantly involved in binding of the substrate or cofactor. in contrast the PAH mutant, S349T, showed an 18-fold increase in K-m for phenylalanine, showing the first functional evidence that this residue was binding at or near the phenylalanine binding site. This confirms the recently published model for the binding of phenylalanine to the PAH active site that postulated S349 interacts with the amino group on the main chain of the phenylalanine molecule. This result differs with that found for the equivalent mutation (S395T), in the closely related tyrosine hydroxylase, which had no effect on substrate K-m, showing that while the architecture of the two active sites are very similar the amino acids that bind to the respective substrates are different. (C) 2000 Academic Press.

Impact of on-site testing for maternal syphilis on treatment delays, treatment rates, and perinatal mortality in rural South Africa: a randomised controlled trial

Background: Syphilis remains a significant cause of preventable perinatal death in developing countries with many women remaining untested and thus untreated. Syphilis testing in the clinic (on-site testing) may be a useful strategy to overcome this. We studied the impact of on-site syphilis testing on treatment delays and rates, and perinatal mortality. Methods: We conducted a cluster randomised controlled trial among seven pairs of primary healthcare clinics in rural South Africa, comparing on-site testing complemented by laboratory confirmation versus laboratory testing alone. Intervention clinics used the on-site test conducted by primary care nurses, with results and treatment available within an hour. Control clinics sent blood samples to the provincial laboratory, with results returned 2 weeks later. Results: Of 7134 women seeking antenatal care with available test results, 793 (11.1%) tested positive for syphilis. Women at intervention clinics completed treatment 16 days sooner on average (95% confidence interval: 11 to 21), though there was no significant difference in the proportion receiving adequate treatment at intervention (64%) and control (69%) clinics. There was also no significant difference in the proportion experiencing perinatal loss (3.3% v 5.1%; adjusted risk difference: -0.9%; 95% Cl -4.4 to 2.7). Conclusions: Despite reducing treatment delays, the addition of on-site syphilis testing to existing laboratory testing services did not lead to higher treatment rates or reduce perinatal mortality. However on-site testing for syphilis may remain an important option for improving antenatal care in settings where laboratory facilities are not available.

Site-directed mutagenesis of dimethylsulfoxide reductase from Rhodobacter capsulatus: The critical roles of tyrosine-114 and tryptophan-116

The crystal structure of six functionally-distinct enzymes of the DMSO reductase family of molybdenum enzymes has revealed that the tertiary structure of the polypeptide that binds the bis(MGD)Mo cofactor is highly conserved. Differences in the catalytic properties of enzymes of this family are almost certainly dependent upon differences in the structure ofthe MO active site. In DMSO reductase from Rhodobacter species tryptophan- 116 (W 116) hydrogen-bonds to an 0x0 group coordinated to the MO ion. In addition a second amino acid side chain from tyrosine-114 (Y 114) is in close proximity to the 0x0 group. We have investigated the role of Y 114 and W 116 in DMSO reductase using site-directed mutagenesis,

Proteasomal degradation of N-acetyltransferase 1 is prevented by acetylation of the active site cysteine - A mechanism for the slow acetylator phenotype and substrate-dependent down-regulation

Many drugs and chemicals found in the environment are either detoxified by N-acetyltransferase 1 (NAT1, EC 2.3.1.5) and eliminated from the body or bioactivated to metabolites that have the potential to cause toxicity and/or cancer. NAT1 activity in the body is regulated by genetic polymorphisms as well as environmental factors such as substrate-dependent down-regulation and oxidative stress. Here we report the molecular mechanism for the low protein expression from mutant NAT1 alleles that gives rise to the slow acetylator phenotype and show that a similar process accounts for enzyme down-regulation by NAT1 substrates. NAT1 allozymes NAT1 14, NAT1 15, NAT1 17, and NAT1 22 are devoid of enzyme activity and have short intracellular half-lives (similar to4 h) compared with wild-type NAT1 4 and the active allozyme NAT1 24. The inactive allozymes are unable to be acetylated by cofactor, resulting in ubiquitination and rapid degradation by the 26 S proteasome. This was confirmed by site-directed mutagenesis of the active site cysteine 68. The NAT1 substrate p-aminobenzoic acid induced ubiquitination of the usually stable NAT1 4, leading to its rapid degradation. From this study, we conclude that NAT1 exists in the cell in either a stable acetylated state or an unstable non-acetylated state and that mutations in the NAT1 gene that prevent protein acetylation produce a slow acetylator phenotype.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

The structure of versutoxin (delta-atracotoxin-Hv1) provides insights into the binding of site 3 neurotoxins to the voltage-gated sodium channel

Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.