Proteomic analysis of normal and malignant prostate tissue to identify novel proteins lost in cancer

BACKGROUND. Alterations of important protein pathways, including loss of prostate secretory granules, and disruption of the prostatic secretory pathway have been identified as early events in malignancy. In this study, proteomics was used to map the differences in protein expression between normal and malignant prostate tissues and to identify and analyze differentially expressed proteins in human prostate tissue with particular regard to the proteins lost in malignancy. METHODS. Small quantities of normal and malignant prostate tissue were taken fresh from 34 radical prostatectomy cases. After histological examination, proteins were solubilized from selected tissues and separated using two-dimensional electrophoresis. Using image analysis, the proteome of normal and malignant tissues were mapped and differentially expressed proteins (present in normal and absent in malignant tissue) were identified and subsequently analyzed using peptide mass finger printing and N-terminal sequencing. Western blotting and immunohistochemistry were performed to examine expression profiles and tissue localization of candidate proteins. RESULTS. Comparison of protein maps of normal and malignant prostate were used to identify 20 proteins which were lost in malignant transformation, including prostate specific antigen (PSA), alpha-l antichymotrypsin (ACT), haptoglobin, and lactoylglutathione lyase. Three of the 20 had not previously been reported in human prostate tissue (Ubiquitin-like NEDD8, calponin, and a follistatin-related protein). Western blotting confirmed differences in the expression profiles of NEDD8 and calponin, and immunohistochemistry demonstrated differences in the cellular localization of these two proteins in normal and malignant prostate glands. CONCLUSIONS. The expression of NEDD8, calponin, and the follistatin-related protein in normal prostate tissues is a novel finding and the role of these important functional proteins in normal prostate and their loss or reduced expression in prostate malignancy warrants further investigations. (C) 2002 Wiley-Liss, Inc.

Relationship of interleukin-6 and tumor necrosis factor-alpha with muscle mass and muscle strength in elderly men and women: The health ABC study

Background. A decline in muscle mass and muscle strength characterizes normal aging. As clinical and animal studies show it relationship between higher cytokine levels and low muscle mass, the aim of this study was to investigate whether markers, of inflammation are associated with muscle mass and strength in well-functioning elderly persons. Methods. We Used baseline data (1997-1998) of the Health, Aging, and Body Composition (Health ABC) Study on 3075 black and white men and women aged 70-79 years. Midthigh muscle cross-sectional area (computed tomography), appendicular muscle mass (dual-energy x-ray ab absorptiometry). isokinetic knee extensor strength (KinCom). and isometric inip strength were measured. plasma levels of interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-alpha) were assessed by enzyme-linked immunosorbent assay (ELISA). Results. Higher cytokine levels were generally associated with lower muscle mass and lower muscle strength. The most consistent relationship across the gender and race groups was observed for IL-6 and grip strength: per SD increase in IL-6, grip strength was 1.1 to 2.4 kg lower (p < .05) after adjustment for age, clinic Site. health status, medications, physical activity. smoking. height. and body fat. Ail overall measure of elevated cytokine level was created by combining the levels of IL-6 and TNF-alpha. With the exception of white men, elderly persons having high levels of IL-6 (> 1.80 pg/ml) as well as high levels of TNF-alpha (> 3.20 pg/ml) had a smaller muscle area, less appendicular mass. a lower knee extensor strength. and a lower grip strength compared to those with low levels of both cytokines. Conclusions. Higher plasma concentrations of IL-6 and TNF-alpha are associated with lower muscle mass and lower muscle strength in well-functioning older men and women. Higher cytokine levels. as often observed in healthy older persons. may contribute to the loss Of muscle mass and strength that accompanies aging.

Surface reflectance properties of Antarctic moss and their relationship to plant species, pigment composition and photosynthetic function

In this study the variations in surface reflectance properties and pigment concentrations of Antarctic moss over species, sites, microtopography and with water content were investigated. It was found that species had significantly different surface reflectance properties, particularly in the region of the red edge (approximately 700 nm), but this did not correlate strongly with pigment concentrations. Surface reflectance of moss also varied in the visible region and in the characteristics of the red edge over different sites. Reflectance parameters, such as the photochemical reflectance index (PRI) and cold hard band were useful discriminators of site, microtopographic position and water content. The PRI was correlated both with the concentrations of active xanthophyll-cycle pigments and the photosynthetic light use efficiency, F-v/F-m, measured using chlorophyll fluorescence. Water content of moss strongly influenced the amplitude and position of the red-edge as well as the PRI, and may be responsible for observed differences in reflectance properties for different species and sites. All moss showed sustained high levels of photoprotective xanthophyll pigments, especially at exposed sites, indicating moss is experiencing continual high levels of photochemical stress.

Semiochemicals and social signaling in the wild European rabbit in Australia: II. Variations in chemical composition of chin gland secretion across sampling sites

The volatile components of the chin gland secretion of the wild European rabbit, Oryctolagus cuniculus (L.), were investigated with the use of gas chromatography. Studies of the chemical nature of this secretion by previous workers demonstrated that it was important in the maintenance of social structure in this species. This study identified 34 different volatile components that consist primarily of aromatic and aliphatic hydrocarbons. Especially common are a series of alkyl-substituted benzene derivatives that provide most of the compound diversity in the secretion. Samples of chin gland secretion collected from animals at three different geographical locations, separated by more than 100 km, showed significant differences in composition. This work suggests that variation among populations needs to be considered when undertaking semiochemical research. Alternate nonparametric methods are also used for the analysis of chromatographic data.

Development and subunit composition of synaptic NMDA receptors in the amygdala: NR2B Synapses in the adult central amygdala

NMDA receptors are well known to play an important role in synaptic development and plasticity. Functional NMDA receptors are heteromultimers thought to contain two NR1 subunits and two or three NR2 subunits. In central neurons, NMDA receptors at immature glutamatergic synapses contain NR2B subunits and are largely replaced by NR2A subunits with development. At mature synapses, NMDA receptors are thought to be multimers that contain either NR1/NR2A or NR1/NR2A/NR2B subunits, whereas receptors that contain only NR1/NR2B subunits are extrasynaptic. Here, we have studied the properties of NMDA receptors at glutamatergic synapses in the lateral and central amygdala. We find that NMDA receptor-mediated synaptic currents in the central amygdala in both immature and mature synapses have slow kinetics and are substantially blocked by the NR2B-selective antagonists (1S, 2S)-1-(4-hydroxyphenyl)-2-(4-hydroxy-4-phenylpiperidino)-1-propano and ifenprodil, indicating that there is no developmental change in subunit composition. In contrast, at synapses on pyramidal neurons in the lateral amygdala, whereas NMDA EPSCs at immature synapses are slow and blocked by NR2B-selective antagonists, at mature synapses their kinetics are faster and markedly less sensitive to NR2B-selective antagonists, consistent with a change from NR2B to NR2A subunits. Using real-time PCR and Western blotting, we show that in adults the ratio of levels of NR2B to NR2A subunits is greater in the central amygdala than in the lateral amygdala. These results show that the subunit composition synaptic NMDA receptors in the lateral and central amygdala undergo distinct developmental changes.

Tissue-specific expression of head-to-tail cyclized miniproteins in Violaceae and structure determination of the root cyclotide Viola hederacea root cyclotide1

The plant cyclotides are a family of 28 to 37 amino acid miniproteins characterized by their head-to-tail cyclized peptide backbone and six absolutely conserved Cys residues arranged in a cystine knot motif: two disulfide bonds and the connecting backbone segments form a loop that is penetrated by the third disulfide bond. This knotted disulfide arrangement, together with the cyclic peptide backbone, renders the cyclotides extremely stable against enzymatic digest as well as thermal degradation, making them interesting targets for both pharmaceutical and agrochemical applications. We have examined the expression patterns of these fascinating peptides in various Viola species (Violaceae). All tissue types examined contained complex mixtures of cyclotides, with individual profiles differing significantly. We provide evidence for at least 57 novel cyclotides present in a single Viola species (Viola hederacea). Furthermore, we have isolated one cyclotide expressed only in underground parts of V, hederacea and characterized its primary and three-dimensional structure. We propose that cyclotides constitute a new family of plant defense peptides, which might constitute an even larger and, in their biological function, more diverse family than the well-known plant defensins.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Evidence that two independent host genes influence the severity of tissue damage and susceptibility to acute pyelonephritis in murine systemic candidiasis

Tissue damage in the kidney and brain after systemic infection with Candida albicans was examined in recombinant inbred strains (AKXL) derived from AKR and C57/L progenitors. Nine of the 15 strains showed mild (C57/L-like) tissue damage. Of the remainder, two strains developed lesions comparable to the AKR parental strain, whereas four exhibited a much move severe pattern of tissue damage. This was characterized by pronounced mycelial growth in the brain, and gross oedema of the kidney, with extensive fungal colonization and marked tissue destruction. The presence of the null allele of the haemolytic complement gene (Hc) may be necessary but not sufficient, for the expression of the very severe lesions. The results were interpreted as reflecting the actions of two independent genes, which have been designated Carg1 and Carg2 (Candida albicans resistance genes 1 and 2). (C) 1997 Academic Press Limited.

Lipid content and fatty acid composition of 11 species of Queensland (Australia) fish

The fatty acid composition of 11 species of fish caught off the northeast coast of Australia was determined. No fatty acid profiles have been previously published for fish from this area nor for nine of these species. Although the percentage of polyunsaturated fatty acid (PU FA) was the same as the calculated average for Australian fish (42.3%), the percentage of n-3 fatty acids was lower (24.4 +/- 5.4% vs. 30.7 +/- 10.1%) and the n-6 fatty acids higher (16.5 +/- 4.5% vs. 11.2 +/- 5.9%), P < 0.001 in each case. The major n-3 PUFA were docosahexaenoic (15.6 +/- 6.3%) and eicosapentaenoic acid (4.3 +/- 1.1%) while the major n-6 PUFA were arachidonic (8.3 +/- 3.2%) and n-6 docosatetraenoic acid (3.1 +/- 1.3%). The second-most abundant class of fatty acid was the saturates (31.6 +/- 3.5%) while the monounsaturates accounted for 17.4 +/- 4.3% of the total fatty acids. The monounsaturate with the highest concentration was octadecenoic acid (11.8 +/- 2.6%). There was a positive correlation between the total lipid content and saturated and monounsaturated fatty acids (r = 0.675 and 0.567, respectively) and a negative correlation between the total lipid content and PUFA(r = 0.774).

Increased tissue resistance in the nude mouse against Candida albicans without altering strain-dependent differences in susceptibility

Strain differences in tissue responses to infection with Candida albicans were examined in nude mice having susceptible (CBA/CaH) and resistant (BALB/c) parentage. Homozygous (nu/nu) mice of both strains were more resistant to systemic infection with C. albicans than heterozygous (nu/+) littermates as indicated by a reduction in both the severity of tissue damage and colony counts in the brain and kidney. However, the tissue lesions in nu/nu CBA/CaH mice were markedly more severe than those in nu/nu mice with the BALB/c background. This pattern was reflected in the greater fungal burden in the CBA/CaH strain. Analysis of cDNA from infected tissues using a competitive polymerase chain reaction excluded interferon-gamma (IFN-gamma), tumour necrosis factor-alpha (TNF-alpha), and interleukin 6 (IL-6) as mediators of the enhanced resistance of the nude mice. The results confirm that the different patterns of lesion severity in BALB/c and CBA/CaH mice do not involve T lymphocyte-mediated pathology, and are consistent with the hypothesis that strain-dependent tissue damage is not dependent on the effector function of macrophages or their precursors.

Effect of body composition at selection on reproductive development in large white gilts

Fifty-four Large White gilts were used to determine the effect of body composition at selection (145 d of age) on the onset of puberty and subsequent reproductive development until 202 d of age. Gilts were assigned to one of three groups based on their backfat depth at selection: 10 to 12 mm (L), 13 to 15 mm (M), and 16 to 18 mm (F). All of the F gilts, 92% of the M gilts, and 67% of the L gilts reached puberty by slaughter at 202 d of age. Data from a subgroup (first 67% to reach puberty in each group; L = Lp, M = Mp, and F = Fp) was also used. The M (Mp) and F (Fp) gilts reached puberty at 172 d (166 d) and 170 d (166 d) of age, respectively, but the L (Lp) gilts at 184.5 d were 12 d (18 d) older than M(P < .05), Mp(P < .001), and F(P < .01), Fp (P < .001) gilts. The Lp (97.68 kg) and Mp (98.33 kg) gilts were lighter (P < .01) than Fp (108.72 kg) gilts at puberty. There were no differences (P < .05) among the L, M, and F gilts in terms of backfat depth or weight at puberty. The L (Lp) gilts had a mean of 1.16 (1.75) estrous cycles, which was lower (P < .01) than for M (Mp) and (P < .01) F (Fp) gilts, with 1.96 (2.29) and 2.25 (2.33) cycles, respectively. L (Lp) gilts had fewer (P < .05) follicles, 13.14 (12.63), than either M (Mp), 19.08 (18.71), or F (Fp), 18.25 (17.42) gilts. The number of corpora lutea was not influenced (P > .05) by grouping at selection, but Fp gilts had fewer (P < .05) corpora lutea than Mp or Fp gilts. Live weight at slaughter was not influenced (P > .10) by grouping at selection or subgrouping at puberty. The L gilts with a mean of 18.05 mm of backfat at slaughter were leaner (P < .05) than the F (21.66 mm) but not (P > .10) the M gilts (19.41 mm). Subgrouping had no effect. Fat deposition and protein deposition were higher (P < .05) in those animals that attained puberty. We conclude that the rate of fat and protein deposition seems to be one of the determinants of puberty attainment.