Site-directed mutagenesis of dimethylsulfoxide reductase from Rhodobacter capsulatus: The critical roles of tyrosine-114 and tryptophan-116

The crystal structure of six functionally-distinct enzymes of the DMSO reductase family of molybdenum enzymes has revealed that the tertiary structure of the polypeptide that binds the bis(MGD)Mo cofactor is highly conserved. Differences in the catalytic properties of enzymes of this family are almost certainly dependent upon differences in the structure ofthe MO active site. In DMSO reductase from Rhodobacter species tryptophan- 116 (W 116) hydrogen-bonds to an 0x0 group coordinated to the MO ion. In addition a second amino acid side chain from tyrosine-114 (Y 114) is in close proximity to the 0x0 group. We have investigated the role of Y 114 and W 116 in DMSO reductase using site-directed mutagenesis,

Mental rotation processes in mathematically gifted boys: An fMRI investigation

The functional brain organisation of mathematically gifted adolescents may be different from those of average mathematical ability. In this study we used fMRI to examine the neural circuitry that mediates the performance of mathematically gifted boys and average ability controls while engaged in mental rotation. Eight math gifted male adolescents and five average ability male adolescents were presented 18 control and 18 mental rotation trials in two separate blocks. Participants selected one of four test stimuli to match the target stimulus by pressing one of four fibreoptic buttons. The control task required a simple 'best match' for the target stimulus. EPI scans were acquired on a 3-T MR scanner and a fixed effects statistical analysis (SPM99) was used to identify areas of significant activation in the rotation tasks, for the two groups. The results indicate that during mental rotation both groups activate the parietal lobes bilaterally, though to different levels. Moreover, the math gifted are uniformly bilateral in their pattern of activation, and engage some anterior regions not found in those of average ability. These regions include bilateral prefrontal cortex and the right anterior cingulate, which may serve to heighten concentration, and to optimise the pre-planning of purposeful actions.

Does the tendency to act impulsively underlie binge eating and alcohol use problems? An empirical investigation

The co-occurrence of problem drinking and binge eating and purging has been well documented. However, there has been relatively little investigation of etiological models that may influence the development of this co-occurrence. This study tests the hypotheses that impulsivity is heightened in eating disordered women compared with controls, and that women with comorbid bulimia and alcohol use disorders show higher impulsivity than bulimic-only women. The Impulsivity scale, BIS/BAS scales, State Anxiety Inventory, and a behavioural measure of reward responsiveness (CARROT) were administered to 22 women with bulimia, 23 women with comorbid bulimia and alcohol abuse/dependence, and 21 control women. As hypothesised, eating disordered women scored higher than controls on several self-report measures of impulsivity and sorted cards faster during a financially rewarded trial on the behavioural task. Also, as predicted, comorbid women scored higher than bulimic women on the Impulsivity scale. These findings suggest that individual differences in impulsiveness and a tendency to approach rewarding stimuli may contribute to developing these disorders. (C) 2003 Elsevier Ltd. All rights reserved.

Proteasomal degradation of N-acetyltransferase 1 is prevented by acetylation of the active site cysteine - A mechanism for the slow acetylator phenotype and substrate-dependent down-regulation

Many drugs and chemicals found in the environment are either detoxified by N-acetyltransferase 1 (NAT1, EC 2.3.1.5) and eliminated from the body or bioactivated to metabolites that have the potential to cause toxicity and/or cancer. NAT1 activity in the body is regulated by genetic polymorphisms as well as environmental factors such as substrate-dependent down-regulation and oxidative stress. Here we report the molecular mechanism for the low protein expression from mutant NAT1 alleles that gives rise to the slow acetylator phenotype and show that a similar process accounts for enzyme down-regulation by NAT1 substrates. NAT1 allozymes NAT1 14, NAT1 15, NAT1 17, and NAT1 22 are devoid of enzyme activity and have short intracellular half-lives (similar to4 h) compared with wild-type NAT1 4 and the active allozyme NAT1 24. The inactive allozymes are unable to be acetylated by cofactor, resulting in ubiquitination and rapid degradation by the 26 S proteasome. This was confirmed by site-directed mutagenesis of the active site cysteine 68. The NAT1 substrate p-aminobenzoic acid induced ubiquitination of the usually stable NAT1 4, leading to its rapid degradation. From this study, we conclude that NAT1 exists in the cell in either a stable acetylated state or an unstable non-acetylated state and that mutations in the NAT1 gene that prevent protein acetylation produce a slow acetylator phenotype.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Investigation of the relationship between protein, message and inducer concentrations in recombinant E-coli cells

Chloramphenicol acetyl transferase (CAT) protein and mRNA levels in E. coli were determined following induction of a tac::cat construct by isopropyl-beta-thiogalactopyranoside (IPTG). High cat mRNA levels did not directly reflect CAT protein levels, in either shakeflask experiments or fermentations. Furthermore, concentrations of IPTG resulting in the highest levels of expression of cat mRNA, were different to those resulting in highest levels of CAT protein. The data suggest that high transcriptional activities lead to limitations at the translational level.

An investigation of the anti-pronation effect of two taping methods after application and exercise

This study investigated the effect of two anti-pronation taping techniques on vertical navicular height, an indicator of foot pronation, after its application and 20 min of exercise. The taping techniques were: the low dye (LD) and low dye with the addition of calcaneal slings and reverse sixes (LDCR). A repeated measures study was used. It found that LDCR was superior to LD and control immediately after application and exercise. LD was better than control immediately after application but not after exercise. These findings provide practical directions to clinicians regularly using anti-pronation taping techniques.

A synthesis of the findings from the Quake Impact Study: A two year investigation of the psychosocial sequelae of the 1989 Newcastle earthquake

This paper summarises the major findings from the Quake Impact Study (QIS), a four-phase longitudinal project that was conducted in the aftermath of the 1989 Newcastle (Australia) earthquake. A total of 3,484 subjects participated in at least one component of the QIS, comprising a stratified sample of 3,007 drawn from community electoral rolls and 477 from specially targeted supplementary samples (the injured, the displaced, the owners of damaged businesses, and the helpers). Subjects' initial earthquake experiences were rated in terms of weighted indices of exposure to threat and disruption. Psychological morbidity was measured at each phase using the General Health Questionnaire (GHQ-12) and the Impact of Event Scale (IES). Selected findings and key conclusions are presented for each of six areas of investigation: service utilisation during the first 6 months post-disaster; patterns of earthquake experience and short-term (6-month) psychosocial outcome; earthquake exposure and medium term (2-year) psychosocial outcome; vulnerability factors and medium-term psychosocial outcome: specific community groups at increased risk (e.g., the elderly and immigrants from non-English-speaking backgrounds); the effects of stress debriefing for helpers. Threshold morbidity (i.e., likely caseness) rates are also presented for a broad range of subgroups. In addition to presenting an overview of the QIS, this paper synthesises the major findings and discusses their implications for future disaster management and research from a mental health perspective.

An investigation into the synthesis of polycarbazole squaraine derivatives

The polycondensation of squaric acid with 1,2-(9-Ethylcarbazol-3-yl)ethene and N-ethyliminostilbene in polyphosphoric acid yielded insoluble polymers which included substituted phosphate groups on the phenyl rings. The presence of phosphorus in these polymers was identified using solid-state P-31 NMR and EDAX techniques. Furthermore the phosphate groups were not ionic, hence no charge-balancing anions were present; Both polymers did not electrically conduct but exhibited dielectric breakdown values of 0.1 and 0.06 MV cm(-1) respectively.

The uncharged surface features surrounding the active site of Escherichia coli DsbA are conserved and are implicated in peptide binding

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.