Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Illicit Opiate Abuse

Illicit opiate use, especially injected drugs, contributes to premature mortality and morbidity in many developed and developing societies. The economic costs of illicit drug use are substantial. Fatal overdoses and HIV/AIDS resulting from sharing dirty needles and injecting equipment are major contributors to mortality and morbidity. Illicit opioid use accounted for 0.7 percent of global disability–adjusted life years in 2000. An estimated 15.3 million people, or 0.4 percent of the world population ages 15 to 64, used illicit opioids in 2002, with more than half using heroin and the rest using opium or diverted pharmaceuticals such as buprenorphine, methadone, or morphine. The most popular interventions for illicit opioid dependence in many developed societies have been law enforcement efforts to interdict the drug supply and enforce legal sanctions against drug use. One consequence has been that illicit opioid users have been exposed to the least effective intervention: imprisonment for drug or property offenses. The most effective intervention to reduce blood–borne virus infection resulting from illicit drug injections is provision of clean injecting equipment to users. This intervention has been widely supported in developed countries, but less so in developing countries. In addition, vaccinations are effective against hepatitis B. In treatment settings, the most popular interventions have been detoxification and drug–free treatment, which has proven the least productive in retaining opioid–dependent people in treatment. Opioid agonists have a niche role in treatment of opioid dependence, especially if their efficacy improves with development of long–acting injectable forms of the drug.