81 resultados para PARTNER CHROMOSOMES


Relevância:

10.00% 10.00%

Publicador:

Resumo:

The unactivated steroid receptors are chaperoned into a conformation that is optimal for binding hormone by a number of heat shock proteins, including Hsp90, Hsp70, Hsp40, and the immunophilin, FKBP52 (Hsp56). Together with its partner cochaperones, cyclophilin 40 (CyP40) and FKBP51, FKBP52 belongs to a distinct group of structurally related immunophilins that modulate steroid receptor function through their association with Hsp90. Due to the structural similarity between the component immunophilins, FKBP52 and cyclophilin 40, we decided to investigate whether CyP40 is also a heat shock protein. Exposure of MCF-7 breast cancer cells to elevated temperatures (42 degreesC for 3 hours) resulted in a 75-fold increase in CyP40 mRNA levels, but no corresponding increase in CyP40 protein expression, even after 7 hours of heat stress. The use of cycloheximide to inhibit protein synthesis revealed that in comparison to MCF-7 cells cultured at 37 degreesC, those exposed to heat stress (42 degreesC for 3 hours) displayed an elevated rate of degradation of both CyP40 and FKBP52 proteins. Concomitantly, the half-life of the CyP40 protein was reduced from more than 24 hours to just over 8 hours following heat shock. As no alteration in CyP40 protein levels occurred in cells exposed to heat shock, an elevated rate of degradation would imply that CyP40 protein was synthesized at an increased rate. hence the designation of human CyP40 as a heat shock protein. Application of heat stress elicited a marked redistribution of CyP40 protein in MCF-7 cells from a predominantly nucleolar localization, with some nuclear and cytoplasmic staining, to a pattern characterized by a pronounced nuclear accumulation of CyP40, with no distinguishable nucleolar staining. This increase in nuclear CyP40 possibly resulted from a redistribution of cytoplasmic and nucleolar CyP40, as no net increase in CyP40 expression levels occurred in response to stress. Exposure of MCF-7 cells to actinomycin D for 4 hours resulted in the translocation of the nucleolar marker protein, B23, from the nucleolus, with only a small reduction in nucleolar CyP40 levels. Under normal growth conditions, MCF-7 cells exhibited an apparent colocalization of CyP40 and FKBP52 within the nucleolus.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Although several genes for idiopathic epilepsies from families with simple Mendelian inheritance have been found, genes for the common idiopathic generalized epilepsies, where inheritance is complex, presently are elusive. We studied a large family with epilepsy where the two main phenotypes were childhood absence epilepsy (CAE) and febrile seizures (FS), which offered a special opportunity to identify epilepsy genes. A total of 35 family members had seizures over four generations. The phenotypes comprised typical CAE (eight individuals); FS alone (15), febrile seizures plus (FS+) (three); myoclonic astatic epilepsy (two); generalized epilepsy with tonic-clonic seizures alone (one); partial epilepsy (one); and unclassified epilepsy despite evaluation (two). In three remaining individuals, no information was available. FS were inherited in an autosomal dominant fashion with 75% penetrance. The inheritance of CAE in this family was not simple Mendelian, but suggestive of complex inheritance with the involvement of at least two genes. A GABA(A) receptor gamma2 subunit gene mutation on chromosome 5 segregated with FS, FS+ and CAE, and also occurred in individuals with the other phenotypes. The clinical and molecular data suggest that the GABA(A) receptor subunit mutation alone can account for the FS phenotype. An interaction of this gene with another gene or genes is required for the CAE phenotype in this family. Linkage analysis for a putative second gene contributing to the CAE phenotype suggested possible loci on chromosomes 10, 13, 14 and 15. Examination of these loci in other absence pedigrees is warranted.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Two experiments examined whether a measure of implicit stereotyping based on the tendency to explain Black stereotype-incongruent events more often than Black stereotype-congruent events (Stereotypic Explanatory Bias or SEB) is predictive of behavior toward a partner in an interracial interaction. In Experiment I SEB predicted White males' choice to ask stereotypic questions of a Black female (but not a White male or White female) in an interview. In Experiment 2 the type of explanation (internal or external attribution) made for stereotype-inconsistency was examined. Results showed that White participants who made internal attributions for Black stereotype-incongruent behavior were rated more positively and those who made external attributions were rated more negatively by a Black male confederate. These results point to the potential of implicit stereotyping as an important predictor of behavior in an interracial interaction. (C) 2002 Elsevier Science (USA). All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this paper, genetic algorithm (GA) is applied to the optimum design of reinforced concrete liquid retaining structures, which comprise three discrete design variables, including slab thickness, reinforcement diameter and reinforcement spacing. GA, being a search technique based on the mechanics of natural genetics, couples a Darwinian survival-of-the-fittest principle with a random yet structured information exchange amongst a population of artificial chromosomes. As a first step, a penalty-based strategy is entailed to transform the constrained design problem into an unconstrained problem, which is appropriate for GA application. A numerical example is then used to demonstrate strength and capability of the GA in this domain problem. It is shown that, only after the exploration of a minute portion of the search space, near-optimal solutions are obtained at an extremely converging speed. The method can be extended to application of even more complex optimization problems in other domains.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Objective: To determine the factors associated with general practitioners' current practice location, with particular emphasis on rural location. Design: Observational, retrospective, case-control study using a self-administered questionnaire. Setting: Australian general practices in December 2000. Participants: 2414 Australian-trained rural and urban GPs. Main outcome measure: Current urban or rural practice location. Results: For Australia as a whole, rural GPs were more likely to be male (odds ratio [OR], 1.42; 95% CI, 1.17-1.73), Australian-born (OR, 1.95; 95% CI, 1.55-2.45), and to report attending a rural primary school for some (OR, 2.21; 95% CI, 1.69-2.89) or all (OR, 2.79; 95% CI, 1.94-4.00) of their primary schooling. Rural GPs' partners or spouses were also more likely to report some (OR, 2.75; 95% CI, 2.07-3.66) or all (OR, 2.86; 95% CI, 2.02-4.05) rural primary schooling. A rural background in both GP and partner produced the highest likelihood of rural practice (OR, 6.28; 95% CI, 4.26-9.25). For individual jurisdictions, a trend towards more rural GPs being men was only significant in Tasmania. In all jurisdictions except Tasmania and the Northern Territory, rural GPs were more likely to be Australian-born. Conclusions: GPs' and their partners' rural background (residence and primary and secondary schooling) influences choice of practice location, with partners' background appearing to exert more influence.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This article presents the findings from a secondary analysis of the 1991 Queensland Crime Victim Survey. Although now more than 10 years old, this survey still has validity as it remains the largest of its kind conducted in Queensland, and it is a rich source of information about the experiences of victims of violence. The study investigated how the experiences of younger female assault victims differ from older female victims in terms of their relationship with their aggressor and the assault location. The following factors were examined: whether or not the assault occurred (a) at the hands of a partner or former partner, (b) in a private dwelling, (c) in a public place, and (d) in a leisure venue away from home. Results pointed to important differences between younger and older women in terms of their experiences of violence. Teenage women reported significantly more assaults in public places compared with older women, and were less likely to be assaulted in their own dwelling. Also, trends in the data suggested that compared to older women, teenage women were more likely to be assaulted in leisure venues away from home, and were less likely to be assaulted by partners or former partners. Considering that young women are at a much higher risk than older women of being assaulted, consideration of these age differences may be helpful in the design of violence prevention strategies. In particular, more attention should be paid to the public place prevention of violence against young women.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background: The purpose of the present paper was to investigate whether screening for abdominal aortic aneurysm (AAA) causes health-related quality of life to change in men or their partners. Methods: A cross-sectional case-control comparison was undertaken of men aged 65-83 years living in Perth, Western Australia, using questionnaires incorporating three validated instruments (Medical Outcomes Study Short Form-36, EuroQol EQ-5D and Hospital Anxiety and Depression Scale) as well as several independent questions about quality of life. The 2009 men who attended for ultrasound scans of the abdominal aorta completed a short prescreening questionnaire about their perception of their general health. Four hundred and ninety-eight men (157 with an AAA and 341 with a normal aorta) were sent two questionnaires for completion 12 months after screening, one for themselves and one for their partner, each being about the quality of life of the respondent. Results: Men with an AAA were more limited in performing physical activities than those with a normal aorta (t-test of means P = 0.04). After screening, men with an AAA were significantly less likely to have current pain or discomfort than those with a normal aorta (multivariate odds ratio: 0.5; 95% confidence interval (Cl): 0.3-0.9) and reported fewer visits to their doctor. The mean level of self-perceived general health increased for all men from before to after screening (from 63.4 to 65.4). Conclusions: Apart from physical functioning, screening was not associated with decreases in health and well-being. A high proportion of men rated their health over the year after screening as being either the same or improved, regardless of whether or not they were found to have an AAA.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Lentil is a self-pollinating diploid (2n = 14 chromosomes) annual cool season legume crop that is produced throughout the world and is highly valued as a high protein food. Several abiotic stresses are important to lentil yields world wide and include drought, heat, salt susceptibility and iron deficiency. The biotic stresses are numerous and include: susceptibility to Ascochyta blight, caused by Ascochyta lentis; Anthracnose, caused by Colletotrichum truncatum; Fusarium wilt, caused by Fusarium oxysporum; Sclerotinia white mold, caused by Sclerotinia sclerotiorum; rust, caused by Uromyces fabae; and numerous aphid transmitted viruses. Lentil is also highly susceptible to several species of Orabanche prevalent in the Mediterranean region, for which there does not appear to be much resistance in the germplasm. Plant breeders and geneticists have addressed these stresses by identifying resistant/tolerant germplasm, determining the genetics involved and the genetic map positions of the resistant genes. To this end progress has been made in mapping the lentil genome and several genetic maps are available that eventually will lead to the development of a consensus map for lentil. Marker density has been limited in the published genetic maps and there is a distinct lack of co-dominant markers that would facilitate comparisons of the available genetic maps and efficient identification of markers closely linked to genes of interest. Molecular breeding of lentil for disease resistance genes using marker assisted selection, particularly for resistance to Ascochyta blight and Anthracnose, is underway in Australia and Canada and promising results have been obtained. Comparative genomics and synteny analyses with closely related legumes promises to further advance the knowledge of the lentil genome and provide lentil breeders with additional genes and selectable markers for use in marker assisted selection. Genomic tools such as macro and micro arrays, reverse genetics and genetic transformation are emerging technologies that may eventually be available for use in lentil crop improvement.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Familial Mediterranean fever (FMF) is a recessively inherited disorder characterized by dramatic episodes of fever and serosal inflammation. This report describes the cloning of the gene likely to cause FMF from a 115-kb candidate interval on chromosome 16p. Three different missense mutations were identified in affected individuals, but not in normals. Haplotype and mutational analyses disclosed ancestral relationships among carrier chromosomes in populations that have been separated for centuries. The novel gene encodes a 3.7-kb transcript that is almost exclusively expressed in granulocytes. The predicted protein, pyrin, is a member of a family of nuclear factors homologous to the Ro52 autoantigen. The cloning of the FMF gene promises to shed light on the regulation of acute inflammatory responses.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Familial Mediterranean fever (FMF) is a recessive disorder of inflammation caused by mutations in a gene (designated MEFV) on chromosome 16p13.3, We have recently constructed a 1-Mb cosmid contig that includes the FMF critical region. Here we show genotype data for 12 markers from our physical map, including 5 newly identified microsatellites, in FMF families. Intrafamilial recombinations placed MEFV in the similar to 285 kb between D16S468/D16S3070 and D16S3376. We observed significant linkage disequilibrium in the North African Jewish population, and historical recombinants in the founder haplotype placed MEFV between D16S3082 and D16S3373 (similar to 200 kb). In smaller panels of Iraqi Jewish, Arab, and Armenian families, there were significant allelic associations only for D16S3370 and D16S2617 among the Armenians. A sizable minority of Iraqi Jewish and Armenian carrier chromosomes appeared to be derived from the North African Jewish ancestral haplotype. We observed a unique FMF haplotype common to Iraqi Jews, Arabs, and Armenians and two other haplotypes restricted to either the Iraqi Jewish or the Armenian population. These data support the view that a few major mutations account for a large percentage of the cases of FMF and suggest that same of these mutations arose before the affected Middle Eastern populations diverged from one another. (C) 1997 Academic Press.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Protein, amino acids and ammonium were the main forms of soluble soil nitrogen in the soil solution of a subtropical heathland (wallum). After fire, soil ammonium and nitrate increased 90- and 60-fold, respectively. Despite this increase in nitrate availability after fire, wallum species exhibited uniformly low nitrate reductase activities and low leaf and xylem nitrate, During waterlogging soil amino acids increased, particularly gamma-aminobutyric acid (GABA) which accounted for over 50% of amino nitrogen. Non-mycorrhizal wallum species were significantly (P < 0.05) N-15-enriched (0.3-4.3 parts per thousand) compared to species with mycorrhizal associations (ericoid-type, ecto-, va-mycorrhizal) which were strongly depleted in N-15 (-6.3 to -1.8 parts per thousand). Lignotubers and roots had delta(15)N signatures similar to that of the leaves of respective species. The exceptions were fine roots of ecto-, ecto/va-, and ericoid type mycorrhizal species which were enriched in N-15 (0.1-2 4 parts per thousand). The delta(15)N signatures of delta(15)N(total soil N) and delta(15)N(soil NH4+) were in the range 3.7-4.5 parts per thousand, whereas delta(15)N(soil NO3-) was significantly (P < 0.05) more enriched in N-15 (9.2-9.8 parts per thousand). It is proposed that there is discrimination against N-15 during transfer of nitrogen from fungal to plant partner. Roots of selected species incorporated nitrogen sources in the order of preference: ammonium > glycine > nitrate. The exception were proteoid roots of Hakea (Proteaceae) which incorporated equal amounts of glycine and ammonium.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Hyperplastic polyposis is a loosely defined syndrome initially thought not to confer a clinically important predisposition to colorectal cancer. The aim of the current study was to examine the clinical, histologic, and molecular features of a prospective series of cases meeting a strict definition of the condition. Twelve patients were identified, seven of whom had developed colorectal cancer. Most polyps were hyperplastic, but 11 patients also had polyps containing dysplasia as either serrated adenomas. mixed polyps, or traditional adenomas. The mean percentage of dysplastic polyps in patients with cancer was 35%, and in patients without cancer, 11%(p < 0.05). Microsatellite instability (MSI) was present in 3 of 47 hyperplastic polyps and two of right serrated adenomas. Kras was mutated in 8 of 47 hyperplastic polyps and two of eight serrated adenomas. No polyps showed loss of heterozygosity of chromosomes 5q, 1p, or 18q. Two of seven cancers showed a high level of MSI. It is concluded that hyperplastic polyposis is associated with a high risk of colorectal cancer. Hyperplastic polyps are the dominant type of polyp, but most cases have some dysplastic epithelium. A higher proportion of dysplastic polyps is associated with increased cancer risk. Clonal generic changes are observed in some hyperplastic polyps and serrated adenomas.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Prader-Willi syndrome (PWS) was originally described less than 50 y ago,1 although reference to children with characteristics of the syndrome are to be found in other literature previous to this.2 Until relatively recently the diagnosis was made upon the clinical features as outlined by Holm,3 which include severe muscular hypotonia in the neonatal period leading to feeding difficulties and undernutrition, hypogonadism and later hyperphagia and obesity. Latterly the syndrome has been identified as being associated with an interstitial deletion of the q11-13 region on chromosome 15.4 In the majority of cases the deletion is in the paternally derived chromosome. In the remainder of cases there seems to be a failure to inherit the entire paternal chromosome and as a consequence both the chromosomes inherited are maternal, thus leading to maternal disomy.