55 resultados para Orthogonal polynomials of a discrete variable


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The present study contributes to theory and practice through the development of a model of shift-work tolerance with the potential to indicate interventions that reduce nurses' intention toward turnover and increase job satisfaction in hospital-based settings. Survey data from 1257 nurses were used to conduct structural equation modeling that examine the direct and indirect effects of supervisor and colleague support, team identity, team climate, and control over working environment on time-based work/life conflict, psychological well-being, physical symptoms, job satisfaction, and turnover intention. The analysis of the proposed model revealed a good fit The chi-square difference test was non-significant (χ2(26)=338.56), the fit indices were high (CFI=.923, NFI=.918, and NNFI=.868), the distribution of residuals was symmetric and approached zero, the average standardized residual was low (AASR=.04), and the standardized RMR was .072. In terms of the predictor variable, the final model explained 48% of the variance in turnover intention. The data revealed considerable evidence of both direct effects on adjustment and complex indirect links between levels of adjustment and work-related social support, team identity, team climate, and control. Nurses with high supervisor and coworker support experienced more positive team climates, identified more strongly with their team, and increased their perceptions of control over their work environment. This in turn lowered their appraisals of their time-based work/life conflict, which consequently increased their psychological well-being and job satisfaction and reduced their physical health symptoms and turnover intention. The type of shift schedule worked by the nurses influenced levels of turnover intention, control over work environment, time-based work/life conflict, and physical symptoms.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recentiy a neuropsychological model of learning has been proposed Qackson, 2002) which argues that Responsibility provides a cognitive re-expression of Impulsivit)' in the prediction of functional and dysfunctional behaviour. Jackson argues that primitive, instinctive impulses lead to antisocial behaviours and socio-cognitive regulators such as Responsibility leads to the re-expression of Impulsivity in terms of pro-social behaviours. Study 1 tests and supports the measurement properties of the assessment methodology associated with the model. Study 2 provides evidence in favour of the instinctive basis of Impulsivity and the conscious basis of Responsibility, which reinforces the underlying neuropsychological basis of the model. Study 3 uses structural equation modelling to determine if Responsibility mediates Impulsivity in the prediction of a latent variable representing work performance, work commitment and team performance, but does not mediate Impulsivit}' in the prediction of a latent variable representing sexual proclivity, workplace deviancy, gambling and beer consumption. Results provide strong support for Jackson's model and suggest that Impulsivity and Responsibility are fundamental to both functional and dysfunctional learning

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We investigate the relative complexity of two free-variable labelled modal tableaux(KEM and Single Step Tableaux, SST). We discuss the reasons why p-simulation is not a proper measure of the relative complexity of tableaux-like proof systems, and we propose an improved comparison scale (p-search-simulation). Finally we show that KEM p-search-simulates SST while SST cannot p-search-simulate KEM.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A general, fast wavelet-based adaptive collocation method is formulated for heat and mass transfer problems involving a steep moving profile of the dependent variable. The technique of grid adaptation is based on sparse point representation (SPR). The method is applied and tested for the case of a gas–solid non-catalytic reaction in a porous solid at high Thiele modulus. Accurate and convergent steep profiles are obtained for Thiele modulus as large as 100 for the case of slab and found to match the analytical solution.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The literature examining purported relationships between ownership of companion animals and health is extremely heterogeneous. While much of the descriptive literature tends to support benefits of animal companionship, large scale, controlled research yields inconsistent and even contradictory findings on several issues, including associations with cardiovascular disease, mood and wellbeing. In an analysis of a large longitudinal data-set from the Australian Longitudinal Study on Women's Health, a prospective study of a nationally representative sample of more than 12,000 older women, difficulties with disentangling the effects of powerful demographic variables and age-related factors from the specific effects of pet ownership became apparent. Both cross-sectional and longitudinal analyses demonstrated that associations between mental and physical health and pet ownership as well as changes in pet ownership over time were weak and inconsistent compared to the large effects of living arrangements and other demographic variables. As sociodemographic variables relate strongly to both health and opportunities for pet ownership, this high level of confounding means it is unlikely that the impact of the specific variable of pet ownership on health can be ascertained from such studies. Rather, well-designed experimental studies, wherein the majority of such confounding variables can be held constant or at least somewhat controlled, are needed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A continuum model for regular block structures is derived by replacing the difference quotients of the discrete equations by corresponding differential quotients. The homogenization procedure leads to an anisotropic Cosserat Continuum. For elastic block interactions the dispersion relations of the discrete and the continuous models are derived and compared. Yield criteria for block tilting and sliding are formulated. An extension of the theory for large deformation is proposed. (C) 1997 by John Wiley & Sons, Ltd.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We demonstrate that a system obeying the complex Lorenz equations in the deep chaotic regime can be controlled to periodic behavior by applying a modulation to the pump parameter. For arbitrary modulation frequency and amplitude there is no obvious simplification of the dynamics. However, we find that there are numerous windows where the chaotic system has been controlled to different periodic behaviors. The widths of these windows in parameter space are narrow, and the positions are related to the ratio of the modulation frequency of the pump to the average pulsation frequency of the output variable. These results are in good agreement with observations previously made in a far-infrared laser system.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We study the continuous problem y"=f(x,y,y'), xc[0,1], 0=G((y(0),y(1)),(y'(0), y'(1))), and its discrete approximation (y(k+1)-2y(k)+y(k-1))/h(2) =f(t(k), y(k), v(k)), k = 1,..., n-1, 0 = G((y(0), y(n)), (v(1), v(n))), where f and G = (g(0), g(1)) are continuous and fully nonlinear, h = 1/n, v(k) = (y(k) - y(k-1))/h, for k =1,..., n, and t(k) = kh, for k = 0,...,n. We assume there exist strict lower and strict upper solutions and impose additional conditions on f and G which are known to yield a priori bounds on, and to guarantee the existence of solutions of the continuous problem. We show that the discrete approximation also has solutions which approximate solutions of the continuous problem and converge to the solution of the continuous problem when it is unique, as the grid size goes to 0. Homotopy methods can be used to compute the solution of the discrete approximation. Our results were motivated by those of Gaines.