Apiomorpha gullanae sp n., an unusual new species of gall-inducing scale insect (Hemiptera : Eriococcidae)

An unusual new species of the gall-inducing scale insect genus Apiomorpha Rubsaamen is described from Queensland. The adult female, its gall, and the first-instar nymph (crawler) are illustrated, and relationships of the new species are estimated using mitochondrial COII data. Adult females induce cigar-shaped galls on leaves of several eucalypts in section Adnataria of subgenus Symphyomyrtus. The bilobed anal lobes of the adult female differ from those of all other Apiomorpha species (single lobe) and the first-instar nymph possesses features, such as broad frontal tubercles and dorsal stripes, that are not present in crawlers of other Apiomorpha species. However, DNA sequence data confirm that the new species falls within Apiomorpha, rather than representing a sister group, and indicate that the new species is not closely related to the A. pharetrata (Schrader) species-group, the only other group within Apiomorpha that induces cigar-shaped galls on leaves. The systematic affiliations of A. gullanae sp. n. are currently not known. Females only are known and there is some indication that reproduction in the new taxon is parthenogenetic. This represents the first putative case of parthenogenesis in Apiomorpha.

The gall-inducing habit has evolved multiple times among the eriococcid scale insects (Sternorrhyncha : Coccoidea : Eriococcidae)

The habit of inducing plant galls has evolved multiple times among insects but most species diversity occurs in only a few groups, such as gall midges and gall wasps. This phylogenetic clustering may reflect adaptive radiations in insect groups in which the trait has evolved. Alternatively, multiple independent origins of galling may suggest a selective advantage to the habit. We use DNA sequence data to examine the origins of galling among the most speciose group of gall-inducing scale insects, the eriococcids. We determine that the galling habit has evolved multiple times, including four times in Australian taxa, suggesting that there has been a selective advantage to galling in Australia. Additionally, although most gall-inducing eriococcid species occur on Myrtaceae, we found that lineages feeding on Myrtaceae are no more likely to have evolved the galling habit than those feeding on other plant groups. However, most gall-inducing species-richness is clustered in only two clades (Apiomorpha and Lachnodius + Opisthoscelis), all of which occur exclusively on Eucalyptus s.s. The Eriococcidae and the large genus Eriococcus were determined to be non-monophyletic and each will require revision. (C) 2004 The Linnean Society of London.

Mitochondrial genome data alone are not enough to unambiguously resolve the relationships of Entognatha, Insecta and Crustacea sensu lato (Arthropoda)

An analysis of the relationships of the major arthropod groups Was undertaken using mitochondrial genome data to examine the hypotheses that Hexapoda is polyphyletic and that Collembola is more closely related to branchiopod crustaceans than insects. We sought to examine the sensitivity of this relationship to outgroup choice, data treatment. gene choice and optimality criteria used in the phylogenetic analysis of mitochondrial genome data. Additionally we sequenced the mitochondrial genome of ail archaeognathan, Nesomachilis australica. to improve taxon selection in the apterygote insects, a group poorly represented in previous mitochondrial phylogenies. The sister group of the Collembola was rarely resolved in our analyses with a significant level of support. The use of different outgroups (myriapods, nematodes, or annelids + mollusks) resulted in many different placements of Collembola. The way in which the dataset was coded for analysis (DNA, DNA with the exclusion of third codon position and as amino acids) also had marked affects on tree topology. We found that nodal Support was spread evenly throughout the 13 mitochondrial genes and the exclusion of genes resulted in significantly less resolution in the inferred trees. Optimality criteria had a much lesser effect on topology than the preceding factors; parsimony and Bayesian trees for a given data set and treatment were quite similar. We therefore conclude that the relationships of the extant arthropod groups as inferred by mitochondrial genomes are highly vulnerable to outgroup choice, data treatment and gene choice, and no consistent alternative hypothesis of Collembola's relationships is supported. Pending the resolution of these identified problems with the application of mitogenomic data to basal arthropod relationships, it is difficult to justify the rejection of hexapod monophyly, which is well supported on morphological grounds. (c) The Willi Hennig Society 2004.

Generic delimitation and phylogenetic uncertainty: An example from a group that has undergone an explosive radiation

Phylogenetic trees can provide a stable basis for a higher-level classification of organisms that reflects evolutionary relationships. However, some lineages have a complex evolutionary history that involves explosive radiation or hybridisation. Such histories have become increasingly apparent with the use of DNA sequence data for phylogeny estimation and explain, in part, past difficulties in producing stable morphology-based classifications for some groups. We illustrate this situation by using the example of tribe Mirbelieae (Fabaceae), whose generic classification has been fraught for decades. In particular, we discuss a recent proposal to combine 19 of the 25 Mirbelieae genera into a single genus, Pultenaea sens. lat., and how we might find stable and consistent ways to squeeze something as complex as life into little boxes for our own convenience. © CSIRO.

Report of the equine herpesvirus-1 Havermeyer Workshop, San Gimignano, Tuscany, June 2004

Amongst the infectious diseases that threaten equine health, herpesviral infections remain a world wide cause of serious morbidity and mortality. Equine herpesvirus-1 infection is the most important pathogen, causing an array of disorders including epidemic respiratory disease abortion, neonatal foal death, myeloencephalopathy and chorioretinopathy. Despite intense scientific investigation, extensive use of vaccination, and established codes of practice for control of disease outbreaks, infection and disease remain common. While equine herpesvirus-1 infection remains a daunting challenge for immunoprophylaxis, many critical advances in equine immunology have resulted in studies of this virus, particularly related to MHC-restricted cytotoxicity in the horse. A workshop was convened in San Gimignano, Tuscany, Italy in June 2004, to bring together clinical and basic researchers in the field of equine herpesvirus-1 study to discuss the latest advances and future prospects for improving our under-standing of these diseases, and equine immunity to herpesviral infection. This report highlights the new information that was the focus of this workshop, and is intended to summarize this material and identify the critical questions in the field. (c) 2006 Elsevier B.V. All rights reserved.

Identification and characterization of a G protein-coupled receptor homolog encoded by murine cytomegalovirus

This report describes the identification of a murine cytomegalovirus (MCMV) G protein-coupled receptor (GCR) homolog. This open reading frame (M33) is most closely related to, and collinear with, human cytomegalovirus UL33, and homologs are also present in human herpesvirus 6 and 7 (U12 for both viruses). Conserved counterparts in the sequenced alpha- or gammaherpesviruses have not been identified to date, suggesting that these genes encode proteins which are important for the biological characteristics of betaherpesviruses. We have detected transcripts for both UL33 and M33 as early as 3 or 4 h postinfection, and these reappear at late times. In addition, we have identified N-terminal splicing for both the UL33 and M33 RNA transcripts. For both open reading frames, splicing results in the introduction of amino acids which are highly conserved among known GCRs. To characterise the function of the M33 in the natural host, two independent MCMV recombinant viruses were prepared, each of which possesses an M33 open reading frame which has been disrupted with the beta-galactosidase gene. While the recombinant M33 null viruses showed no phenotypic differences in replication from wild-type MCMV in primary mouse embryo fibroblasts in vitro, they showed severely restricted growth in the salivary glands of infected mice. These data suggest that M33 plays an important role in vivo, in particular in the dissemination to or replication in the salivary gland, and provide the first evidence for the function of a viral GCR homolog in vivo.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Lipopolysaccharide biosynthesis genes in koala type I Chlamydia: Cloning and characterization

We showed in 1988 that there are two strains of Chlamydia psittaci which infect the koala (Phascolarctos cinereus). In order to further investigate the role of these chlamydial strains in pathogenesis, we have attempted to identify genes of koala type I strain chlamydial which are involved in the immunogenic response, Transformation of Escherichia coli with a plasmid containing a 6.3-kb fragment (pKOC-10) of C. psittaci DNA caused the appearance of a specific chlamydial lipopolysaccharide (LPS) epitope on the host strain. The smallest DNA fragment capable of inducing the expression of chlamydial LPS was an Xbal fragment, 2.4 kb in size (pKOC-5). DNA sequence analysis of the complete fragment revealed regions of high identity, at the amino acid level, to the gseA genes of C. pneomoniae, C. psittaci 6BC and C. trachomatis, and the kdtA gene of E. coli which code for transferases catalysing the addition of 3-deoxy-D-manno-octulosonic acid (Kdo) residues to lipid A. Two open reading frames (ORFs) of 1,314 and 501 nucleotides in size, within the 2.4-kb fragment, were evident, and mRNA species corresponding to these ORFs were detected by Northern analysis. Both ORF1 and ORF2 are required for the appearance of chlamydia-specific LPS on the surface of recombinant E. coli.

Cell compartmentalisation in planctomycetes: novel types of structural organisation for the bacterial cell

The organisation of cells of the planctomycete species Pirellula marina, Isosphaera pallida, Gemmata obscuriglobus, Planctomyces mat-is and Candidatus Brocadia anammoxidans was investigated based on ultrastructure derived from thin-sections of cryosubstituted cells, freeze-fracture replicas, and in the case of Gemmata obscuriglobus and Pirellllla marina, computer-aided 3-D reconstructions from serial sections of cryosubstituted cells. All planctomycete cells display a peripheral ribosome-free region, termed here the paryphoplasm, surrounding the perimeter of the cell, and an interior region including any nucleoid regions as well as ribosome-like particles, bounded by a single intracytoplasmic membrane (ICM), and termed the pirellulosome in Pirellula species. Immunogold labelling and RNase-gold cytochemistry indicates that in planctomycetes all the cell DNA is contained wholly within the interior region bounded by the ICM, and the paryphoplasm contains no DNA but at least some of the cell's RNA. The ICM in Isosphaera pallida and Planctomyces mat-is is invaginated such that the paryphoplasm forms a major portion of the cell interior in sections, but in other planctomycetes it remains as a peripheral zone. In the anaerobic ammonium-oxidising (anammox process) chemoautotroph Candidatus Brocadia anammoxidans the interior region bounded by ICM contains a further internal single-membrane-bounded region, the anam-moxosome. In Gemmata obscuriglobus. the interior ICM-bounded region contains the nuclear body, a double-membrane-bounded region containing the cell's nucleoid and all genomic DNA in addition to some RNA. Shared features of cell compartmentalisation in different planctomycetes are consistent with the monophyletic nature of the planctomycetes as a distinct division of the Bacteria. The shared organisational plan for the planctomycete cell constitutes a new type not known in cells of other bacteria.

Height discordance in monozygotic females is not attributable to discordant inactivation of X-linked stature determining genes

We tested the hypothesis that X-linked genes determining stature which are subject to skewed or non-random X-inactivation can account for discordance in height in monozygotic female twins. Height discordant female monozygotic adult twins (20 pairs) were identified from the Australian Twin Registry, employing the selection criteria of proven monozygosity and a measured height discordance of at least 5 cm. Differential X-inactivation was examined in genomic DNA extracted from peripheral lymphocytes by estimating differential methylation of alleles at the polymorphic CAG triplet repeat of the Androgen receptor gene (XAR). There were 17/20 MZ pairs heterozygous at this locus and informative for analysis. Of these, 10/17 both had random X-inactivation, 5/17 showed identical X-inactivation patterns of non random inactivation and 2/17 (12%) showed discordant X-inactivation. There was no relationship between inactivation patterns and self-report chorionicity. We conclude that non-random X-inactivation does not appear to be a major contributor to intra-pair height discordance in female MZ twins.

Numerous gene rearrangements in the mitochondrial genome of the wallaby louse, Heterodoxus macropus (Phthiraptera)

The complete arrangement of genes in the mitochondrial (mt) genome is known for 12 species of insects, and part of the gene arrangement in the mt genome is known for over 300 other species of insects. The arrangement of genes in the mt genome is very conserved in insects studied, since all of the protein-coding and rRNA genes and most of the tRNA genes are arranged in the same way. We sequenced the entire mt genome of the wallaby louse, Heterodoxus macropus, which is 14,670 bp long and has the 37 genes typical of animals and some noncoding regions. The largest noncoding region is 73 bp long (93% A+T), and the second largest is 47 bp long (92% AST). Both of these noncoding regions seem to be able to form stem-loop structures. The arrangement of genes in the mt genome of this louse is unlike that of any other animal studied. All tRNA genes have moved and/or inverted relative to the ancestral gene arrangement of insects, which is present in the fruit fly Drosophila yakuba. At least nine protein-coding genes (atp6, atp8, cox2, cob, nad1-nad3, nad5, and nad6) have moved; moreover, four of these genes (atp6, atp8, nad1, and nad3) have inverted. The large number of gene rearrangements in the mt genome of H. macropus is unprecedented for an arthropod.

Recent advances in our knowledge of the Myxozoa

In the last few years two factors have helped to significantly advance our understanding of the Myxozoa. First, the phenomenal increase in fin fish aquaculture in the 1990s has lead to the increased importance of these parasites; in rum this has lead to intensified research efforts, which have increased knowledge of the development, diagnosis, and pathogenesis of myxozoans. The hallmark discovery in the 1980s that the life cycle of Myxobolus cerebralis requires development of an actinosporean stage in the Oligochaete. Tubifex tubifex, led to the elucidation of the life cycles of several other myxozoans. Also, the life cycle and taxonomy of the enigmatic PKX myxozoan has been resolved: it is the alternate stage of the unusual myxozoan. Tetracapsula bryosalmonae, from bryozoans. The 18S rDNA gene of many species has been sequenced, and here we add 22 new sequences to the data set. Phylogenetic analyses using all these sequences indicate that: 1) the Myxozoa are closely related to Cnidaria (also supported by morphological data), 2) marine taxa at the genus level branch separately from genera that usually infect freshwater fishes; 3) taxa cluster more by development and tissue location than by spore morphology; 4) the tetracapsulids branched off early in myxozoan evolution, perhaps reflected by their having bryozoan. rather than annelid hosts; 5) the morphology of actinosporeans offers little information for determining their myxosporean counterparts (assuming that they exist), and 6) the marine actinosporeans from Australia appear to form a clade within the platysporinid myxosporeans. Ribosomal DNA sequences have also enabled development of diagnostic tests for myxozoans. PCR and in situ hybridisation tests based on rDNA sequences have been developed for Myxobolus cerebralis. Ceratomyxa shasta. Kudoa spp,, and Tetracapsula bryosalmonae (PKX). Lectin-based and antibody tests have also been developed for certain myxozoans, such as PKX and C. shasta. We also review important diseases caused by myxozoans. which are emerging or re-emerging. Epizootics of whirling disease in wild rainbow trout (Oncorhynchus mykiss) have recently been reported throughout the Rocky Mountain states of the USA. With a dramatic increase in aquaculture of fishes using marine netpens, several marine myxozoans have been recognized or elevated in status as pathological agents. Kudoa thyrsites infections have caused severe post-harvest myoliquefaction in pen-reared Atlantic salmon (Salmo salar), and Ceratomyxa spp., Sphaerospora spp., and Myxidium leei cause disease in pen-reared sea bass (Dicentrarchus labrax) and sea bream species (family Sparidae) in Mediterranean countries.

Analysis of the TGF beta functional pathway in epithelial ovarian carcinoma

Epithelial ovarian carcinoma is often diagnosed at an advanced stage of disease and is the leading cause of death from gynaecological neoplasia. The genetic changes that occur during the development of this carcinoma are poorly understood. It has been proposed that IGFIIR, TGF beta1 and TGF beta RII act as a functional unit in the TGF beta growth inhibitory pathway, and that somatic loss-of-function mutations in any one of these genes could lead to disruption of the pathway and subsequent loss of cell cycle control. We have examined these 3 genes in 25 epithelial ovarian carcinomas using single-stranded conformational polymorphism analysis and DNA sequence analysis. A total of 3 somatic missense mutations were found in the TGF beta RII gene, but none in IGFRII or TGF beta1. An association was found between TGF beta RII mutations and histology, with 2 out of 3 clear cell carcinomas having TGF beta RII mutations. This data supports other evidence from mutational analysis of the PTEN and beta -catenin genes that there are distinct developmental pathways responsible for the progression of different epithelial ovarian cancer histologic subtypes. (C) 2001 Cancer Research Campaign.

On surrogate methods for detecting lateral gene transfer

Surrogate methods for detecting lateral gene transfer are those that do not require inference of phylogenetic trees. Herein I apply four such methods to identify open reading frames (ORFs) in the genome of Escherichia coli K12 that may have arisen by lateral gene transfer. Only two of these methods detect the same ORFs more frequently than expected by chance, whereas several intersections contain many fewer ORFs than expected. Each of the four methods detects a different non-random set of ORFs. The methods may detect lateral ORFs of different relative ages; testing this hypothesis will require rigorous inference of trees. (C) 2001 Federation of European Microbiological Societies. Published by Elsevier Science BN. All rights reserved.

Mouse Sox8 is located between, not within, the t-complex deletions t(w18) and t(h20) on chromosome 17

The SOX family of developmental transcription factors is known to play critical roles in cell lineage specification, fate determination and differentiation during development in diverse phyla. Their importance is underscored by their involvement in a number of human diseases and mouse mutants, and by targeted mutation in mice. SOX8 is broadly expressed during development and is located on human chromosome 16p and within the t-complex on mouse chromosome 17, in the vicinity of two mutations t(w18) and t(h20). Here we analyse mutant genomic DNA to show that the Sox8 gene locus lies outside the deletion regions of both t(w18) and t(h20) and between these deletions. These data exclude Sox8 from contributing to the t(w18) and t(h20) phenotypes, and provide an additional marker for structural characterization of this complex genomic region. Copyright (C) 2001 S. Karger AG, Basel.