60 resultados para Classical orthogonal polynomials of a discrete variable
Resumo:
Shale-normalised rare earth element and yttrium (REE + Y) patterns for siderite-jasper couples in a banded iron formation of the 3.45 Ga Panorama Formation, Warrawoona Group, eastern Pilbara Craton, display distinct positive Y and Eu anomalies and weak positive La and Gd anomalies, combined with depleted light REE relative to middle and heavy REE. Ambient seawater and hydrothermal fluids are identified as major sources of REE + Y for the BIF. In the case of siderites, strong correlations between incompatible trace elements and trace element ratios diagnostic of seawater indicate variable input from a terrigenous source (e.g. volcanic ash). We propose a volcanic caldera setting as a likely depositional environment where jasper and siderite precipitated as alternating bands in response to episodic changes in ambient water chemistry. The episodicity was either driven by fluctuations in the intensity of hydrothermal activity or changes in magma chamber activity, which in turn controlled relative sea level. In this context, precipitation of jasper probably reflects background conditions during which seawater was saturated in silica due to evaporative conditions, while siderites were deposited most likely during intermittent periods of enhanced volcanic activity when seawater was more acidic due to the release of exhalative phases (e.g. CO2). © 2005 Elsevier B.V. All rights reserved.
Resumo:
Metaplastic breast carcinomas are reported to harbour epidermal growth factor receptor (EGFR) overexpression in up to 80% of the cases, but EGFR gene amplification is the underlying genetic mechanism in around one-third of these. In this study, EGFR gene amplification as defined by chromogenic in situ hybridization and protein overexpression was examined in a cohort of 47 metaplastic breast carcinomas. Furthermore, the presence of activating EGFR mutations in exons 18, 19, 20, and 21 was investigated. Thirty-two cases showed EGFR overexpression and of these, 11 (34%) harboured EGFR gene amplification. In addition, EGFR amplification showed a statistically significant association with EGFR overexpression (p < 0.0094) and was restricted to carcinomas with homologous metaplasia. Ten cases, five with and five without EGFR amplification, were subjected to microarray-based CGH, which demonstrated that EGFR copy number gain may occur by amplification of a discrete genomic region or by gains of the short arm of chromosome 7 with a breakpoint near the EGFR gene locus, the minimal region of amplification mapping to EGFR, LANCL2, and SECOG. No activating EGFR mutations were identified, suggesting that this is unlikely to be a common alternative underlying genetic mechanism for EGFR expression in metaplastic breast carcinomas. Given that metaplastic breast carcinomas are resistant to conventional chemotherapy or hormone therapy regimens and that tumours with EGFR amplification are reported to be sensitive to EGFR tyrosine kinase inhibitors, these findings indicate that further studies are warranted to explore EGFR tyrosine kinase inhibitors as potential therapeutic agents for metaplastic breast carcinomas harbouring amplification of 7p11.2. Copyright (c) 2006 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd
Resumo:
The present study contributes to theory and practice through the development of a model of shift-work tolerance with the potential to indicate interventions that reduce nurses' intention toward turnover and increase job satisfaction in hospital-based settings. Survey data from 1257 nurses were used to conduct structural equation modeling that examine the direct and indirect effects of supervisor and colleague support, team identity, team climate, and control over working environment on time-based work/life conflict, psychological well-being, physical symptoms, job satisfaction, and turnover intention. The analysis of the proposed model revealed a good fit The chi-square difference test was non-significant (χ2(26)=338.56), the fit indices were high (CFI=.923, NFI=.918, and NNFI=.868), the distribution of residuals was symmetric and approached zero, the average standardized residual was low (AASR=.04), and the standardized RMR was .072. In terms of the predictor variable, the final model explained 48% of the variance in turnover intention. The data revealed considerable evidence of both direct effects on adjustment and complex indirect links between levels of adjustment and work-related social support, team identity, team climate, and control. Nurses with high supervisor and coworker support experienced more positive team climates, identified more strongly with their team, and increased their perceptions of control over their work environment. This in turn lowered their appraisals of their time-based work/life conflict, which consequently increased their psychological well-being and job satisfaction and reduced their physical health symptoms and turnover intention. The type of shift schedule worked by the nurses influenced levels of turnover intention, control over work environment, time-based work/life conflict, and physical symptoms.
Resumo:
The classical strength profile of continents(1,2) is derived from a quasi-static view of their rheological response to stress-one that does not consider dynamic interactions between brittle and ductile layers. Such interactions result in complexities of failure in the brittle-ductile transition and the need to couple energy to understand strain localization. Here we investigate continental deformation by solving the fully coupled energy, momentum and continuum equations. We show that this approach produces unexpected feedback processes, leading to a significantly weaker dynamic strength evolution. In our model, stress localization focused on the brittle-ductile transition leads to the spontaneous development of mid-crustal detachment faults immediately above the strongest crustal layer. We also find that an additional decoupling layer forms between the lower crust and mantle. Our results explain the development of decoupling layers that are observed to accommodate hundreds of kilometres of horizontal motions during continental deformation.
Resumo:
Knowledge of the plan competes with self-consciousness of experience. The less we are able to understand our spatio-visual experience by the abstract coordinates of the plan, the more we are thrust back into a lived experience of the building in duration. This formula, frequently unacknowledged, has been one of the main precepts of the experientialist modernism which arises out of the picturesque and which stands in critique of classical idealism. One of the paths to critique this formula is by showing that the attention to the experience of the spaces in duration is predicated on obscuring, complicating and weakening the apprehension of the plan as a figure. Another development in the practice of modern planning has been architects using a kind of over-drawing where human circulation diagrams or 'movement lines' are drawn expressively across the orthographic plane; thus representing the lived experience of buildings. We will show that these two issues are linked; the plan's weak figure and the privilege this supposes for durational experience has a corollary - experience itself demands to be visible in the plan, and this is one origin of the present fascination with 'diagramming'. In this paper we explore the practice of architectural planning and its theoretical underpinnings in an attempt to show the viability of a history of architectural planning methods.
Resumo:
Recentiy a neuropsychological model of learning has been proposed Qackson, 2002) which argues that Responsibility provides a cognitive re-expression of Impulsivit)' in the prediction of functional and dysfunctional behaviour. Jackson argues that primitive, instinctive impulses lead to antisocial behaviours and socio-cognitive regulators such as Responsibility leads to the re-expression of Impulsivity in terms of pro-social behaviours. Study 1 tests and supports the measurement properties of the assessment methodology associated with the model. Study 2 provides evidence in favour of the instinctive basis of Impulsivity and the conscious basis of Responsibility, which reinforces the underlying neuropsychological basis of the model. Study 3 uses structural equation modelling to determine if Responsibility mediates Impulsivity in the prediction of a latent variable representing work performance, work commitment and team performance, but does not mediate Impulsivit}' in the prediction of a latent variable representing sexual proclivity, workplace deviancy, gambling and beer consumption. Results provide strong support for Jackson's model and suggest that Impulsivity and Responsibility are fundamental to both functional and dysfunctional learning
Resumo:
We investigate the relative complexity of two free-variable labelled modal tableaux(KEM and Single Step Tableaux, SST). We discuss the reasons why p-simulation is not a proper measure of the relative complexity of tableaux-like proof systems, and we propose an improved comparison scale (p-search-simulation). Finally we show that KEM p-search-simulates SST while SST cannot p-search-simulate KEM.
Resumo:
A general, fast wavelet-based adaptive collocation method is formulated for heat and mass transfer problems involving a steep moving profile of the dependent variable. The technique of grid adaptation is based on sparse point representation (SPR). The method is applied and tested for the case of a gas–solid non-catalytic reaction in a porous solid at high Thiele modulus. Accurate and convergent steep profiles are obtained for Thiele modulus as large as 100 for the case of slab and found to match the analytical solution.
Resumo:
In quantum measurement theory it is necessary to show how a, quantum source conditions a classical stochastic record of measured results. We discuss mesoscopic conductance using quantum stochastic calculus to elucidate the quantum nature of the measurement taking place in these systems. To illustrate the method we derive the current fluctuations in a two terminal mesoscopic circuit with two tunnel barriers containing a single quasi bound state on the well. The method enables us to focus on either the incoming/ outgoing Fermi fields in the leads, or on the irreversible dynamics of the well state itself. We show an equivalence between the approach of Buttiker and the Fermi quantum stochastic calculus for mesoscopic systems.
Resumo:
The literature examining purported relationships between ownership of companion animals and health is extremely heterogeneous. While much of the descriptive literature tends to support benefits of animal companionship, large scale, controlled research yields inconsistent and even contradictory findings on several issues, including associations with cardiovascular disease, mood and wellbeing. In an analysis of a large longitudinal data-set from the Australian Longitudinal Study on Women's Health, a prospective study of a nationally representative sample of more than 12,000 older women, difficulties with disentangling the effects of powerful demographic variables and age-related factors from the specific effects of pet ownership became apparent. Both cross-sectional and longitudinal analyses demonstrated that associations between mental and physical health and pet ownership as well as changes in pet ownership over time were weak and inconsistent compared to the large effects of living arrangements and other demographic variables. As sociodemographic variables relate strongly to both health and opportunities for pet ownership, this high level of confounding means it is unlikely that the impact of the specific variable of pet ownership on health can be ascertained from such studies. Rather, well-designed experimental studies, wherein the majority of such confounding variables can be held constant or at least somewhat controlled, are needed.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
A continuum model for regular block structures is derived by replacing the difference quotients of the discrete equations by corresponding differential quotients. The homogenization procedure leads to an anisotropic Cosserat Continuum. For elastic block interactions the dispersion relations of the discrete and the continuous models are derived and compared. Yield criteria for block tilting and sliding are formulated. An extension of the theory for large deformation is proposed. (C) 1997 by John Wiley & Sons, Ltd.
Resumo:
We demonstrate that a system obeying the complex Lorenz equations in the deep chaotic regime can be controlled to periodic behavior by applying a modulation to the pump parameter. For arbitrary modulation frequency and amplitude there is no obvious simplification of the dynamics. However, we find that there are numerous windows where the chaotic system has been controlled to different periodic behaviors. The widths of these windows in parameter space are narrow, and the positions are related to the ratio of the modulation frequency of the pump to the average pulsation frequency of the output variable. These results are in good agreement with observations previously made in a far-infrared laser system.
Resumo:
We study the continuous problem y"=f(x,y,y'), xc[0,1], 0=G((y(0),y(1)),(y'(0), y'(1))), and its discrete approximation (y(k+1)-2y(k)+y(k-1))/h(2) =f(t(k), y(k), v(k)), k = 1,..., n-1, 0 = G((y(0), y(n)), (v(1), v(n))), where f and G = (g(0), g(1)) are continuous and fully nonlinear, h = 1/n, v(k) = (y(k) - y(k-1))/h, for k =1,..., n, and t(k) = kh, for k = 0,...,n. We assume there exist strict lower and strict upper solutions and impose additional conditions on f and G which are known to yield a priori bounds on, and to guarantee the existence of solutions of the continuous problem. We show that the discrete approximation also has solutions which approximate solutions of the continuous problem and converge to the solution of the continuous problem when it is unique, as the grid size goes to 0. Homotopy methods can be used to compute the solution of the discrete approximation. Our results were motivated by those of Gaines.