75 resultados para Amplified Spontaneous Emission (ASE)
Resumo:
A system of two two-level atoms interacting with a squeezed vacuum field can exhibit stationary entanglement associated with nonclassical two-photon correlations characteristic of the squeezed vacuum field. The amount of entanglement present in the system is quantified by the well known measure of entanglement called concurrence. We find analytical formulae describing the concurrence for two identical and nonidentical atoms and show that it is possible to obtain a large degree of steady-state entanglement in the system. Necessary conditions for the entanglement are nonclassical two-photon correlations and nonzero collective decay. It is shown that nonidentical atoms are a better source of stationary entanglement than identical atoms. We discuss the optimal physical conditions for creating entanglement in the system; in particular, it is shown that there is an optimal and rather small value of the mean photon number required for creating entanglement.
Resumo:
We derive a master equation for a driven double quantum dot damped by an unstructured phonon bath, and calculate the spectral density. We find that bath-mediated photon absorption is important at relatively strong driving, and may even dominate the dynamics, inducing population inversion of the double-dot system. This phenomenon is consistent with recent experimental observations.
Resumo:
In a recent paper Yu and Eberly [Phys. Rev. Lett. 93, 140404 (2004)] have shown that two initially entangled and afterward not interacting qubits can become completely disentangled in a finite time. We study transient entanglement between two qubits coupled collectively to a multimode vacuum field, assuming that the two-qubit system is initially prepared in an entangled state produced by the two-photon coherences, and find the unusual feature that the irreversible spontaneous decay can lead to a revival of the entanglement that has already been destroyed. The results show that this feature is independent of the coherent dipole-dipole interaction between the atoms but it depends critically on whether or not collective damping is present.
Resumo:
This paper describes an example of spontaneous transitions between qualitatively different coordination patterns during a cyclic lifting and lowering task. Eleven participants performed 12 trials of repetitive lifting and lowering in a ramp protocol in which the height of the lower shelf was raised or lowered 1 cm per cycle between 10 and 50 cm. Two distinct patterns of coordination were evident: a squat technique in which moderate range of hip, knee and ankle movement was utilised and ankle plantar-flexion occurred simultaneously with knee and hip extension; and a stoop technique in which the range of knee movement was reduced and knee and hip extension was accompanied by simultaneous ankle dorsi-flexion. Abrupt transitions from stoop to squat techniques were observed during descending trials, and from squat to stoop during ascending trials. Indications of hysteresis was observed in that transitions were more frequently observed during descending trials, and the average shelf height at the transition was 5 cm higher during ascending trials. The transitions may be a consequence of a trade-off between the biomechanical advantages of each technique and the influence of the lift height on this trade-off.
Resumo:
Strong photoluminescent emission has been obtained from 3 nm PbS nanocrystals in aqueous colloidal solution, following treatment with CdS precursors. The observed emission can extend across the entire visible spectrum and usually includes a peak near 1.95 eV. We show that much of the visible emission results from absorption by higher-lying excited states above 3.0 eV with subsequent relaxation to and emission from states lying above the observed band-edge of the PbS nanocrystals. The fluorescent lifetimes for this emission are in the nanosecond regime, characteristic of exciton recombination.
Resumo:
Genetic markers that distinguish fungal genotypes are important tools for genetic analysis of heterokaryosis and parasexual recombination in fungi. Random amplified polymorphic DNA (RAPD) markers that distinguish two races of biotype B of Colletotrichum gloeosporioides infecting the legume Stylosanthes guianensis were sought. Eighty-five arbitrary oligonucleotide primers were used to generate 895 RAPD bands but only two bands were found to be specifically amplified from DNA of the race 3 isolate. These two RAPD bands were used as DNA probes and hybridised only to DNA of the race 3 isolate. Both RAPD bands hybridised to a dispensable 1.2 Mb chromosome of the race 3 isolate. No other genotype-specific chromosomes or DNA sequences were identified in either the race 2 or race 3 isolates. The RAPD markers hybridised to a 2 Mb chromosome in all races of the genetically distinct biotype A pathogen which infects other species of Stylosanthes as well as S. guianensis. The experiments indicate that RAPD analysis is a potentially useful tool for obtaining genotype-and chromosome-specific DNA probes in closely related isolates of one biotype of this fungal pathogen.
Resumo:
Free-piston-driven expansion tubes are capable of generating flaw conditions over a wide range of enthalpies ranging from orbital up to superorbital velocities. Initial optical measurements aimed at investigating the flow in such a facility are presented. Emission studies were used to identify impurities in the how and to investigate spectral regions that are accessible by optical techniques. At moderate enthalpies, it was found that significant radiation resulted from metallic contaminants. At high enthalpies, the spectrum consisted of a number of atomic lines together with a broadband background component indicative of the presence of electrons. The presence of this radiation may limit the applicability of optical techniques that require spectral regions free from the influence of atomic transitions or background radiation. Emission spectroscopy (through Stark broadened hydrogen lines) and two-wavelength holographic interferometry were used to measure the electron number density behind a bow shock on a blunt body at conditions where significant ionization was observed. They yielded average concentrations of (3 +/- 1) x 10(17) cm(-3) from the emission measurements and (3.8 +/- 0.6) x 10(17) cm(-3) from the interferometry.
Resumo:
We examine a stylized version of EPA auctions when agents know the list of values of sellers and buyers. There are inefficient equilibria where no goods are traded and efficient equilibria where all exchange occurs at a uniform price. We also provide examples under incomplete information when the uniform price equilibrium holds and when it does not hold. (C) 1999 Elsevier Science S.A. All rights reserved. JEL classification: D44; Q29.
Resumo:
Immune surveillance by cytotoxic lymphocytes against cancer has been postulated for decades, but direct evidence for the role of cytotoxic lymphocytes in protecting against spontaneous malignancy has been lacking. As the rejection of many experimental cancers by cytotoxic T lymphocytes and natural killer cells is dependent on the pore-forming protein perforin (pfp), we examined pfp-deficient mice for increased cancer susceptibility. Here we show that pfp-deficient mice have a high incidence of malignancy in distinct lymphoid cell lineages (T, B, NKT), indicating a specific requirement for pfp in protection against lymphomagenesis. The susceptibility to lymphoma was accentuated by simultaneous lack of expression of the p53 gene, mutations in which also commonly predispose to human malignancies, including lymphoma. In contrast, the incidence and age of onset of sarcoma was unaffected in p53-deficient mice. Pfp-deficient mice were at least 1,000-fold more susceptible to these lymphomas when transplanted, compared with immunocompetent mice in which tumor rejection was controlled by CD8(+) T lymphocytes. This study is the first that implicates direct cytotoxicity by lymphocytes in regulating lymphomagenesis.
Resumo:
EDD (E3 isolated by differential display), located at chromosome 8q22.3, is the human orthologue of the Drosophila melanogaster tumour suppressor gene 'hyperplastic discs' and encodes a HECT domain E3 ubiquitin protein-ligase. To investigate the possible involvement of EDD in human cancer, several cancers from diverse tissue sites were analysed for allelic gain or loss (allelic imbalance, AI) at the EDD locus using an EDD-specific microsatellite, CEDD, and other polymorphic microsatellites mapped in the vicinity of the 8q22.3 locus. Of 143 cancers studied, 38 had AI at CEDD (42% of 90 informative cases). In 14 of these cases, discrete regions of imbalance encompassing 8q22.3 were present, while the remainder had more extensive 8q aberrations. AI of CEDD was most frequent in ovarian cancer (22/47 informative cases, 47%), particularly in the serous subtype (16/22, 73%), but was rare in benign and borderline ovarian tumours. AI was also common in breast cancer (31%), hepatocellular carcinoma (46%), squamous cell carcinoma of the tongue (50%) and metastatic melanoma (18%). AI is likely to represent amplification of the EDD gene locus rather than loss of heterozygosity, as quantitative RT-PCR and immunohistochemistry showed that EDD mRNA and protein are frequently overexpressed in breast and ovarian cancers, while among breast cancer cell lines EDD overexpression and increased gene copy number were correlated. These results demonstrate that AI at the EDD locus is common in a diversity of carcinomas and that the EDD gene is frequently overexpressed in breast and ovarian cancer, implying a potential role in cancer progression.
Resumo:
Few studies have demonstrated that innate lymphocytes play a major role in preventing spontaneous tumor formation. We evaluated the development of spontaneous tumors in mice lacking beta-2 microglobulin (beta2m; and thus MHC class I, CD1d, and CD16) and/or perform, since these tumor cells would be expected to activate innate effector cells. Approximately half the cohort of perform gene-targeted mice succumbed to spontaneous disseminated B cell lymphomas and in mice that also lacked beta2m, the lymphomas developed earlier (by more than 100 d) and with greater incidence (84%). B cell lymphomas from perforin/beta2m gene-targeted mice effectively primed cell-mediated cytotoxicity and perform, but not IFN-gamma, IL-12, or IL-18, was absolutely essential for tumor rejection. Activated NK1.1(+) and gammadeltaTCR(+) T cells were abundant at the tumor site, and transplanted tumors were strongly rejected by either, or both, of these cell types. Blockade of a number of different known costimulatory pathways failed to prevent tumor rejection. These results reflect a critical role for NK cells and gammadeltaTCP(+) T cells in innate immune surveillance of B cell lymphomas, mediated by as yet undetermined pathway(s) of tumor recognition.
Resumo:
The suspension Chinese Hamster Ovary cell line, 13-10-302, utilizing the metallothionein (MT) expression system producing recombinant human growth hormone (hGH) was studied in a serum-free and cadmium-free medium at different fermentation scales and modes of operation. Initial experiments were carried out to optimize the concentration of metal addition to induce the MT promoter. Subsequently, the cultivation of the 13-10-302 cell line was scaled up from spinner flasks into bioreactors, and the cultivation duration was extended with fed-batch and perfusion strategies utilizing 180 muM zinc to induce the promoter controlling expression of recombinant hGH. It was shown that a fed-batch process could increase the maximum cell numbers twofold, from 3.3 to 6.3 x 10(6) cell/mL, over those obtained in normal batch fermentations, and this coupled with extended fermentation times resulted in a fourfold increase in final hGH titer, from 135 +/- 15 to 670 +/- 70 mg/L at a specific productivity q(hGH) value of 12 pg cell(-1)d(-1). The addition of sodium butyrate increased the specific productivity of hGH in cells to a value of approximately 48 pg cell(-1)d(-1), resulting in a final hGH titer of over a gram per liter during fed-batch runs. A BioSep acoustic cell recycler was used to retain the cells in the bioreactor during perfusion operation. It was necessary to maintain the specific feeding rates (SFR) above a value of 0.2 vvd/(10(6) cell/mL) to maintain the viability and productivity of the 13-10-302 cells; under these conditions the viable cell number increased to over 107 cell/mL and resulted in a volumetric productivity of over 120 mg(hGH) L(-1)d(-1). Process development described in this work demonstrates cultivation at various scales and sustained high levels of productivity under cadmium free condition in a CHO cell line utilizing an inducible metallothionein expression system. (C) 2004 Wiley Periodicals, Inc.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).