Inheritance and mapping of 11 avirulence genes in Phytophthora sojae

Two new crosses involving four races (races 7, 16, 17, and 25) of the soybean root and stem rot pathogen Phytophthora sojae were established (7/16 cross; 17/25 cross). An F-2 Population derived from each cross was used to determine the genetic basis of avirulence towards 11 different resistance genes in soybean. Avirulence was found to be dominant and determined by a single locus for Avr1b, 1d, 1k, 3b, 4, and 6, as expected for a simple gene-for-gene model. We also observed several cases of segregation, inconsistent with a single dominant gene being solely responsible for avirulence, which suggests that the genetic background of the different crosses can affect avirulence. Avr4 and 6 cosegregated in both the 7/16 and 17/25 crosses and, in the 7/16 cross, Avr1b and 1k were closely linked. Information from segregating RAPD, RFLP, and AFLP markers screened on F-2 progeny from the two new crosses and two crosses described previously (a total of 212 F-2 individuals, 53 from each cross) were used to construct an integrated genetic linkage map of P. sojae. This revised genetic linkage map consists of 386 markers comprising 35 RFLP, 236 RAPD, and 105 AFLP markers, as well as 10 avirulence genes. The map is composed of 21 major linkage groups and seven minor linkage groups covering a total map distance of 1640.4 cM. (C) 2002 Elsevier Science (USA). All rights reserved.

Phytophthora sojae avirulence genes Avr4 and Avr6 are located in a 24kb, recombination-rich region of genomic DNA

A cross between two different races (race 7 x race 25) of the soybean root and stem rot pathogen Phytophthora sojae was analyzed to characterize the genomic region flanking two cosegregating avirulence genes, Anur4 and Anur6. Both genes cosegregated in the ratio of 82:17 (avirulent:virulent) in an F-2 population, suggestive of a single locus controlling both phenotypes. A chromosome walk was commenced from RAPD marker OPE7.1C, 2.0 cM distant from the Anur4/6 locus. Three overlapping cosmids were isolated which included genetic markers that flank the Anur4/6 locus. The chromosome walk spanned a physical distance of 67 kb which represented a genetic map distance of 22.3cM, an average recombination frequency of 3.0kb/cM and 11.7-fold greater than the predicted average recombination frequency of 35.3 kb/cM for the entire P. sojae genome. Six genes (cDNA clones) expressed from the Anur4/6 genomic region encompassed by the cosmid contig were identified. Single nucleotide polymorphisms and restriction fragment length polymorphisms showed these six genes were closely linked to the Anur4/6 locus. Physical mapping of the cDNA clones within the cosmid contig made it possible to deduce the precise linkage order of the cDNAs. None of the six cDNA clones appear to be candidates for Anur4/6. We conclude that two of these cDNA clones flank a physical region of approximately 24 kb and 4.3 cM that appears to include the Anur4/6 locus. (C) 2003 Elsevier Inc. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Identification of an apolipoprotein(e) variant associated with type III hyperlipoproteinaemia in an indigenous Australian

As a result of testing for lipid and apolipoprotein(e) (apo E) phenotype status of an indigenous Australian community, an apo E variant associated with type III hyperlipoproteinaemia has been identified. Apo E phenotype was determined by analysis of VLDL by isoelectric focusing, and genotype on DNA amplified by polymerase chain reaction, using two different restriction enzyme isotyping assays. Phenotypes and genotypes were discordant in samples from two subjects and an abnormal-sized restriction fragment was also observed in their genotyping gel patterns. DNA sequencing studies revealed this was due to a single nucleotide deletion. 3817delC, at amino acid 136 on apo E. This resulted in a new reading frame and the premature termination of the apo E protein due to a stop codon (TGA) at nucleotide 4105. The variant apo E null allele showed a recessive mode of inheritance and, in combination with the E2 allele, resulted in the type III hyperlipoproteinaemic phenotype but when inherited with the E4 allele had no marked effect on plasma lipids.

Transpecific microsatellites for hard pines M. Shepherd, M. Cross, T. Maguire, M. Dieters, C. Williams, R. Henry

Microsatellites are difficult to recover from large plant genomes so cross-specific utilisation is an important source of markers. Fifty micro satellites were tested for cross-specific amplification and polymorphism to two New World hard pine species, slash pine (Pinus elliottii var. elliottii) and Caribbean pine (R caribaea var. hondurensis). Twenty-nine (58%) markers amplified in both hard pine species, and 23 of these 29 were polymorphic. Soft pine (subgenus Strobus) microsatellite markers did amplify, but none were polymorphic. Pinus elliottii var. elliottii and R caribaea var. hondurensis showed mutational changes in the flanking regions and the repeat motif that were informative for Pinus spp. phylogenetic relationships. Most allele length variation could be attributed to variability in repeat unit number. There was no evidence for ascertainment bias.

Identification of T cell epitopes on the 33-kDa fragment of Plasmodium yoelii merozoite surface protein 1 and their antibody-independent protective role in immunity to blood stage malarial

Merozoite surface protein 1 (MSP1) of malaria parasites undergoes proteolytic processing at least twice before invasion into a new RBC. The 42-kDa fragment, a product of primary processing, is cleaved by proteolytic enzymes giving rise to MSP1(33), which is shed from the merozoite surface, and MSP1(19), which is the only fragment carried into a new RBC. In this study, we have identified T cell epitopes on MSP1(33) of Plasmodium yoelii and have examined their function in immunity to blood stage malaria. Peptides 20 aa in length, spanning the length of MSP1(33) and overlapping each other by 10 aa, were analyzed for their ability to induce T cell proliferation in immunized BALB/c and C57BL/6 mice. Multiple epitopes were recognized by these two strains of mice. Effector functions of the dominant epitopes were then investigated. Peptides Cm15 and Cm21 were of particular interest as they were able to induce effector T cells capable of delaying growth of lethal P. yoelii YM following adoptive transfer into immuno-deficient mice without inducing detectable Ab responses. Homologs of these epitopes could be candidates for inclusion in a subunit vaccine.

A genetic map of macadamia based on randomly amplified DNA fingerprinting (RAF) markers

The first genetic linkage map of macadamia (Macadamia integrifolia and M. tetraphylla) is presented. The map is based on 56 F-1 progeny of cultivars 'Keauhou' and 'A16'. Eighty-four percent of the 382 markers analysed segregated as Mendelian loci. The two-way pseudo-testcross mapping strategy allowed construction of separate parental cultivar maps. Ninety bridging loci enabled merging of these maps to produce a detailed genetic map of macadamia, 1100 cM in length and spanning 70-80% of the genome. The combined map comprised 24 linkage groups with 265 framework markers: 259 markers from randomly amplified DNA fingerprinting (RAF), five random amplified polymorphic DNA (RAPD), and one sequence-tagged microsatellite site (STMS). The RAF marker system unexpectedly revealed 16 codominant markers, one of them a putative microsatellite locus and exhibiting four distinct alleles in the cross. This molecular study is the most comprehensive examination to date of genetic loci of macadamia, and is a major step towards developing marker-assisted selection for this crop.

Turbulent Time and Length Scale Measurements in High-Velocity Open Channel Flows

In high-velocity open channel flows, the measurements of air-water flow properties are complicated by the strong interactions between the flow turbulence and the entrained air. In the present study, an advanced signal processing of traditional single- and dual-tip conductivity probe signals is developed to provide further details on the air-water turbulent level, time and length scales. The technique is applied to turbulent open channel flows on a stepped chute conducted in a large-size facility with flow Reynolds numbers ranging from 3.8 E+5 to 7.1 E+5. The air water flow properties presented some basic characteristics that were qualitatively and quantitatively similar to previous skimming flow studies. Some self-similar relationships were observed systematically at both macroscopic and microscopic levels. These included the distributions of void fraction, bubble count rate, interfacial velocity and turbulence level at a macroscopic scale, and the auto- and cross-correlation functions at the microscopic level. New correlation analyses yielded a characterisation of the large eddies advecting the bubbles. Basic results included the integral turbulent length and time scales. The turbulent length scales characterised some measure of the size of large vortical structures advecting air bubbles in the skimming flows, and the data were closely related to the characteristic air-water depth Y90. In the spray region, present results highlighted the existence of an upper spray region for C > 0.95 to 0.97 in which the distributions of droplet chord sizes and integral advection scales presented some marked differences with the rest of the flow.

A rapid single-step multiplex method for discriminating between Trichogramma (Hymenoptera: Trichogrammatidae) species in Australia

Inaccurate species identification confounds insect ecological studies. Examining aspects of Trichogramma ecology pertinent to the novel insect resistance management strategy for future transgenic cotton, Gossypium hirsutum L., production in the Ord River Irrigation Area (ORIA) of Western Australia required accurate differentiation between morphologically similar Trichogramma species. Established molecular diagnostic methods for Trichogramma identification use species-specific sequence difference in the internal transcribed spacer (ITS)-2 chromosomal region; yet, difficulties arise discerning polymerase chain reaction (PCR) fragments of similar base pair length by gel electrophoresis. This necessitates the restriction enzyme digestion of PCR-amplified ITS-2 fragments to readily differentiate Trichogramma australicum Girault and Trichogramma pretiosum Riley. To overcome the time and expense associated with a two-step diagnostic procedure, we developed a “one-step” multiplex PCR technique using species-specific primers designed to the ITS-2 region. This approach allowed for a high-throughput analysis of samples as part of ongoing ecological studies examining Trichogramma biological control potential in the ORIA where these two species occur in sympatry.

Insect densoviruses may be widespread in mosquito cell lines

A diagnostic PCR assay was designed based on conserved regions of previously sequenced densovirus genomic DNA isolated from mosquitoes. Application of this assay to different insect cell lines resulted in a number of cases of consistent positive amplification of the predicted size fragment. Positive PCR results were subsequently confirmed to correlate with densovirus infection by both electron microscopy and indirect fluorescent antibody test. In each case the nucleotide sequence of the amplified PCR fragments showed high identity to previously reported densoviruses isolated from mosquitoes. Phylogenetic analysis based on these sequences showed that two of these isolates were examples of new densoviruses. These viruses could infect and replicate in mosquitoes when administered orally or parenterally and these infections were largely avirulent. In one virus/mosquito combination vertical transmission to progeny was observed. The frequency with which these viruses were detected would suggest that they may be quite common in insect cell lines.

Specific PCR based detection of Phytophthora medicaginis using the intergenic spacer region of the ribosomal DNA

A technique based on the polymerase chain reaction (PCR) for the specific detection of Phytophthora medicaginis was developed using nucleotide sequence information of the ribosomal DNA (rDNA) regions. The complete IGS 2 region between the 5 S gene of one rDNA repeat and the small subunit of the adjacent repeat was sequenced for P. medicaginis and related species. The entire nucleotide sequence length of the IGS 2 of P. medicaginis was 3566 bp. A pair of oligonucleotide primers (PPED04 and PPED05), which allowed amplification of a specific fragment (364 bp) within the IGS 2 of P. medicaginis using the PCR, was designed. Specific amplification of this fragment from P. medicaginis was highly sensitive, detecting template DNA as low as 4 ng and in a host-pathogen DNA ratio of 1000000:1. Specific PCR amplification using PPED04 and PPED05 was successful in detecting P. medicaginis in lucerne stems infected under glasshouse conditions and field infected lucerne roots. The procedures developed in this work have application to improved identification and detection of a wide range of Phytophthora spp. in plants and soil.

Functional polymorphism of the human arylamine N-acetyltransferase type 1 gene caused by (CT)-T-190 and G(560)A mutations

Human N-acetyltransferase type 1 (NAT1) catalyses the N- or O-acetylation of various arylamine and heterocyclic amine substrates and is able to bioactivate several known carcinogens. Despite wide inter-individual variability in activity, historically, NAT1 was considered to be monomorphic in nature. However, recent reports of allelic variation at the NAT1 locus suggest that it may be a polymorphically expressed enzyme. In the present study, peripheral blood mononuclear cell NAT1 activity in 85 individuals was found to be bimodally distributed with approximately 8% of the population being slow acetylators. Subsequent sequencing of the individuals having slow acetylator status showed all to have either a (CT)-T-190 or G(560)A base substitution located in the protein encoding region of the NAT1 gene. The (CT)-T-190 base substitution changed a highly conserved Arg(64), which others have shown to be essential for fully functional NAT1 protein. The (CT)-T-190 mutation has not been reported previously and we have named it NAT1*17. The G(560)A mutation is associated with the base substitutions previously observed in the NAT1*10 allele and this variant (NAT1*14) encodes for a protein with reduced acetylation capacity. A novel method using linear PCR and dideoxy terminators was developed for the detection of NAT1*14 and NAT1*17. Neither of these variants was found in the rapid acetylator population. We conclude that both the (CT)-T-190 (NAT1*17) and G(560)A (NAT1*14) NAT1 structural variants are involved in a distinct NAT1 polymorphism. Because NAT1 can bioactivate several carcinogens, this polymorphism may have implications for cancer risk in individual subjects. (C) 1998 Chapman & Hall Ltd.

Isolation of genotype- and chromosome-specific DNA markers in a biotype of Colletotrichum gloeosporioides using random amplified polymorphic DNA analysis

Genetic markers that distinguish fungal genotypes are important tools for genetic analysis of heterokaryosis and parasexual recombination in fungi. Random amplified polymorphic DNA (RAPD) markers that distinguish two races of biotype B of Colletotrichum gloeosporioides infecting the legume Stylosanthes guianensis were sought. Eighty-five arbitrary oligonucleotide primers were used to generate 895 RAPD bands but only two bands were found to be specifically amplified from DNA of the race 3 isolate. These two RAPD bands were used as DNA probes and hybridised only to DNA of the race 3 isolate. Both RAPD bands hybridised to a dispensable 1.2 Mb chromosome of the race 3 isolate. No other genotype-specific chromosomes or DNA sequences were identified in either the race 2 or race 3 isolates. The RAPD markers hybridised to a 2 Mb chromosome in all races of the genetically distinct biotype A pathogen which infects other species of Stylosanthes as well as S. guianensis. The experiments indicate that RAPD analysis is a potentially useful tool for obtaining genotype-and chromosome-specific DNA probes in closely related isolates of one biotype of this fungal pathogen.

FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Crystallization of a trimeric human T cell leukemia virus type 1 gp21 ectodomain fragment as a chimera with maltose-binding protein

We present a novel protein crystallization strategy, applied to the crystallization of human T cell leukemia virus type 1 (HTLV-1) transmembrane protein gp21 lacking the fusion peptide and the transmembrane domain, as a chimera with the Escherichia coli maltose binding protein (MBP). Crystals could not be obtained with a MBP/gp21 fusion protein in which fusion partners were separated by a flexible linker, but were obtained after connecting the MBP C-terminal alpha-helix to the predicted N-terminal alpha-helical sequence of gp21 via three alanine residues. The gp21 sequences conferred a trimeric structure to the soluble fusion proteins as assessed by sedimentation equilibrium and X-ray diffraction, consistent with the trimeric structures of other retroviral transmembrane proteins. The envelope protein precursor, gp62, is likewise trimeric when expressed in mammalian cells. Our results suggest that MBP may have a general application for the crystallization of proteins containing N-terminal alpha-helical sequences.