Mutant GABA(A) receptor gamma 2-subunit in childhood absence epilepsy and febrile seizures

Epilepsies affect at least 2% of the population at some time in life, and many forms have genetic determinants(1,2). We have found a mutation in a gene encoding a GABA, receptor subunit in a large family with epilepsy. The two main phenotypes were childhood absence epilepsy (CAE) and febrile seizures (FS), There is a recognized genetic: relationship between FS and CAE, yet the two syndromes have different ages of onset, and the physiology of absences and convulsions is distinct. This suggests the mutation has age-dependent effects on different neuronal networks that influence the expression of these clinically distinct, but genetically related, epilepsy phenotypes. We found that the mutation in GABRG2 (encoding the gamma2-subunit) abolished in vitro sensitivity to diazepam, raising the possibility that endozepines do in fact exist and have a physiological role in preventing seizures.

Generalized epilepsy with febrile seizures plus: Mutation of the sodium channel subunit SCN1B

Generalized epilepsy with febrile seizures plus (GEFS(+)) is an important childhood genetic epilepsy syndrome with heterogeneous phenotypes, including febrile seizures (FS) and generalized epilepsies of variable severity. Forty unrelated GEFS(+) and FS patients were screened for mutations in the sodium channel beta-subunits SCN1B and SCN2B, and the second GEFS(+) family with an SCN1B mutation is described here. The family had 19 affected individuals: 16 with typical GEFS(+) phenotypes and three with other epilepsy phenotypes. Site-specific mutation within SCN1B remains a rare cause of GEFS(+), and the authors found no evidence to implicate SCN2B in this syndrome.

Mental rotation processes in mathematically gifted boys: An fMRI investigation

The functional brain organisation of mathematically gifted adolescents may be different from those of average mathematical ability. In this study we used fMRI to examine the neural circuitry that mediates the performance of mathematically gifted boys and average ability controls while engaged in mental rotation. Eight math gifted male adolescents and five average ability male adolescents were presented 18 control and 18 mental rotation trials in two separate blocks. Participants selected one of four test stimuli to match the target stimulus by pressing one of four fibreoptic buttons. The control task required a simple 'best match' for the target stimulus. EPI scans were acquired on a 3-T MR scanner and a fixed effects statistical analysis (SPM99) was used to identify areas of significant activation in the rotation tasks, for the two groups. The results indicate that during mental rotation both groups activate the parietal lobes bilaterally, though to different levels. Moreover, the math gifted are uniformly bilateral in their pattern of activation, and engage some anterior regions not found in those of average ability. These regions include bilateral prefrontal cortex and the right anterior cingulate, which may serve to heighten concentration, and to optimise the pre-planning of purposeful actions.

Coping with stereotype threat: Denial as an impression management strategy

Four experiments tested the hypothesis that people who are concerned with impression management cope with stereotype threat through denial. Consistent with this hypothesis, temporary employees threatened by a stereotype of incompetence (Study 1) and hostel-dwelling older adults (Study 2) were more likely to deny incompetence if they were high in impression management. African Americans (Study 3) showed a similar pattern of denying cognitive incompetence, which emerged primarily when they were interviewed by a White experimenter and had attended a predominantly Black high school. In Study 4, White students who expected to take an IQ test and were threatened by a stereotype of being less intelligent than Asians were more likely to deny that intelligence is important if they were high in impression management.

Mathematically gifted male adolescents activate a unique brain network during mental rotation

Mental rotation involves the creation and manipulation of internal images, with the later being particularly useful cognitive capacities when applied to high-level mathematical thinking and reasoning. Many neuroimaging studies have demonstrated mental rotation to be mediated primarily by the parietal lobes, particularly on the right side. Here, we use fMRI to show for the first time that when performing 3-dimensional mental rotations, mathematically gifted male adolescents engage a qualitatively different brain network than those of average math ability, one that involves bilateral activation of the parietal lobes and frontal cortex, along with heightened activation of the anterior cingulate. Reliance on the processing characteristics of this uniquely bilateral system and the interplay of these anterior/posterior regions may be contributors to their mathematical precocity.

Individual differences in motivated social cognition: The case of self-serving information processing

Three experiments examined the hypothesis that people show consistency in motivated social cognitive processing across self-serving domains. Consistent with this hypothesis, Experiment 1 revealed that people who rated a task at which they succeeded as more important than a task at which they failed also cheated on a series of math problems, but only when they could rationalize their cheating as unintentional. Experiment 2 replicated this finding and demonstrated that a self-report measure of self-deception did not predict this rationalized cheating. Experiment 3 replicated Experiments 1 and 2 and ruled out several alternative explanations. These experiments suggest that people who show motivated processing in ego-protective domains also show motivated processing in extrinsic domains. These experiments also introduce a new measurement procedure for differentiating between intentional versus rationalized cheating.

The intercalated disc of monkey myocardial cells and Purkinje fibers as revealed by scanning electron microscopy

The intercalated discs of working myocardium and Purkinje fibers of the monkey heart were examined by scanning and transmission electron microscopy. The NaOH/ultrasonication technique resulted in the digestion of connective tissue and a separation of the intercellular junctions of intercalated discs, such that these could be visualized three-dimensionally. The intercalated discs of ventricular myocytes, atrial myocytes and Purkinje fibers vary considerably in number and configuration, as do the intercalated discs of the three different layers of the ventricular myocardium. Myocytes in the subepicardial, middle and subendocardial layers of the ventricle have 1-3, 4-5 and 5-6 intercalated discs at the end of these cells, respectively, Those in the endocardial layer are characterized by the presence of small laterally-placed intercalated discs. Atrial myocytes and Purkinje fibers usually only have 1-2 intercalated discs, Individual intercalated discs in ventricular myocytes have complicated stairs with 10-30 steps and corresponding risers, while those of atrial myocytes and Purkinje fibers have simple stairs with 1-3 steps and risers, Steps equivalent to the plicate segments are characterized by densely-packed microplicae and finger-like microprojections which greatly increase surface area in vertricular myocytes, Microprojections in atrial myocytes and Purkinje fibers are sparse by comparison, Risers equivalent to the interplicate segments containing large gap junctional areas are most numerous in left ventricular myocytes, followed by right ventricular myocytes, Purkinje fibers and atrial myocytes in decreasing order. The geometric arrangement of the various types of myocytes may be related with impulse propagation. Large intercalated discs of cell trunks and series branches may participate in longitudinal propagation, while small laterally-placed ones may be the site of transverse propagation.

Risk attitude, planting conditions and the value of seasonal forecasts to a dryland wheat grower

The value of a seasonal forecasting system based on phases of the Southern Oscillation was estimated for a representative dryland wheat grower in the vicinity of Goondiwindi. In particular the effects on this estimate of risk attitude and planting conditions were examined. A recursive stochastic programming approach was used to identify the grower's utility-maximising action set in the event of each of the climate patterns over the period 1894-1991 recurring In the imminent season. The approach was repeated with and without use of the forecasts. The choices examined were, at planting, nitrogen application rate and cultivar and, later in the season, choices of proceeding with or abandoning each wheat activity, The value of the forecasting system was estimated as the maximum amount the grower could afford to pay for its use without expected utility being lowered relative to its non use.

Elevated plasma membrane and sarcoplasmic reticulum Ca2+ pump mRNA levels in cultured aortic smooth muscle cells from spontaneously hypertensive rats

We have observed previously that Ca2+ pump-mediated Ca2+ efflux is elevated in cultured aortic smooth muscle cells from spontaneously hypertensive rats compared to those from Wistar-Kyoto rat controls. The objective of this work was to determine if these strains differ in mRNA levels for the PMCA1 isoform of the plasma membrane Ca2+-ATPase and the SERCA2 isoform of the sarcoplasmic reticulum Ca2+-ATPase. mRNA levels were compared in cultured aortic smooth muscle cells from 10-week-old male rats. PMCA1 and SERCA2 mRNA levels were elevated in SHR compared to WKY. Angiotensin II increased the level of PMCA1 and SERCA2 mRNA in both strains. These studies provide further evidence for alterered Ca2+ homeostasis in hypertension at the level of Ca2+ transporting ATPases in the spontaneously hypertensive rat model. These data are also consistent with the hypothesis that the expression of these two Ca2+ pumps may be linked. (C) 1997 Academic Press

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Intracellular free Ca2+ and basal Mn2+ influx in cultured aortic smooth muscle cells from spontaneously hypertensive and normotensive Wistar-Kyoto rats.

Numerous studies investigating the possible role of altered Ca2+ homeostasis in hypertension have compared resting and agonist-stimulated intracellular free Ca2+ ([Ca2+](i)) in cultured aortic smooth muscle cells from spontaneously hypertensive (SHR) and normotensive Wistar-Kyoto (WKY) rats. However, such studies have not given consistent results. Differences in the method used to load cells with the Ca2+-sensitive indicator fura-2 have been investigated here as a possible source of variability between studies. We also describe the adaptation of a fluorescence technique for the assessment of basal Ca2+ permeability in SHR and WKY through the measurement of Mn2+ influx. The results are consistent with the hypothesis that basal Ca2+ influx is elevated in cultured aortic smooth muscle cells from SHR compared to those from WKY. However, this was not reflected as a significant difference between the two strains in basal or angiotensin II (200 nmol/L)stimulated [Ca2+](i). Furthermore, this result was not dependent on the protocol used to load cells with fura-2. Hence, measurement of bulk [Ca2+](i) does not appear to be the most sensitive parameter for altered Ca2+ homeostasis in SHR. Other compartments of the cell may better reflect altered Ca2+ fluxes in hypertension and are discussed in this work.

Methimazole and propylthiouracil equally cross the perfused human term placental lobule

Propylthiouracil (PTU) is widely believed to cross the placenta less freely than methimazole (MMI) and is therefore regarded as the preferred drug for treatment of hyperthyroidism in pregnancy. Clinical studies comparing the two drugs show, however, no differences in maternal or fetal thyroid function. We investigated transfer from the maternal to the fetal circuit in the isolated perfused term human placental lobule of low and high doses of PTU (4 mu g/mL and 40 mu g/mL) and MMI(1.5 mu g/mL and 15 mu g/mL) in protein-free perfusate and low doses of both drugs with addition of 40 g/L of bovine albumin. Both drugs readily crossed the placenta, reaching equilibrium in all experiments in about 2 h. Drug concentrations in the two circuits fitted a two compartmental model. Transfer kinetics for the two drugs were similar, nonsaturable, and unaffected by addition of albumin. Clearances (mL.min(-1).g(-1), means +/- SD) of PTU from maternal to fetal circuits were: 0.229 +/- 0.110, 0.216 +/- 0.065, and 0.170 +/- 0.032; and for transfer of MMI: 0.165 +/- 0.025, 0.232 +/- 0.153, and 0.174 +/- 0.009 (for low doses without, low doses with, and high doses without albumin, respectively). Clearances of PTU from fetal to maternal circuits were: 0.147 +/- 0.072, 0.109 +/- 0.014, and 0.116 +/- 0.028; and for transfer of MMI: 0.095 +/- 0.029, 0.122 +/- 0.088, and 0.12 +/- 0.005 (in the same experiments). There was no significant difference between drugs or drug doses and no effect of addition of albumin. We conclude that PTU and MMI have similar placental transfer kinetics.

Casimir invariants and characteristic identities for gl(infinity)

A full set of (higher-order) Casimir invariants for the Lie algebra gl(infinity) is constructed and shown to be well defined in the category O-FS generated by the highest weight (unitarizable) irreducible representations with only a finite number of nonzero weight components. Moreover, the eigenvalues of these Casimir invariants are determined explicitly in terms of the highest weight. Characteristic identities satisfied by certain (infinite) matrices with entries from gl(infinity) are also determined and generalize those previously obtained for gl(n) by Bracken and Green [A. J. Bracken and H. S. Green, J. Math. Phys. 12, 2099 (1971); H. S. Green, ibid. 12, 2106 (1971)]. (C) 1997 American Institute of Physics.

Waterlogging and fire impacts on nitrogen availability and utilization in a subtropical wet heathland (wallum)

Protein, amino acids and ammonium were the main forms of soluble soil nitrogen in the soil solution of a subtropical heathland (wallum). After fire, soil ammonium and nitrate increased 90- and 60-fold, respectively. Despite this increase in nitrate availability after fire, wallum species exhibited uniformly low nitrate reductase activities and low leaf and xylem nitrate, During waterlogging soil amino acids increased, particularly gamma-aminobutyric acid (GABA) which accounted for over 50% of amino nitrogen. Non-mycorrhizal wallum species were significantly (P < 0.05) N-15-enriched (0.3-4.3 parts per thousand) compared to species with mycorrhizal associations (ericoid-type, ecto-, va-mycorrhizal) which were strongly depleted in N-15 (-6.3 to -1.8 parts per thousand). Lignotubers and roots had delta(15)N signatures similar to that of the leaves of respective species. The exceptions were fine roots of ecto-, ecto/va-, and ericoid type mycorrhizal species which were enriched in N-15 (0.1-2 4 parts per thousand). The delta(15)N signatures of delta(15)N(total soil N) and delta(15)N(soil NH4+) were in the range 3.7-4.5 parts per thousand, whereas delta(15)N(soil NO3-) was significantly (P < 0.05) more enriched in N-15 (9.2-9.8 parts per thousand). It is proposed that there is discrimination against N-15 during transfer of nitrogen from fungal to plant partner. Roots of selected species incorporated nitrogen sources in the order of preference: ammonium > glycine > nitrate. The exception were proteoid roots of Hakea (Proteaceae) which incorporated equal amounts of glycine and ammonium.

The metamorphosis of lambda-fold 4-wheel systems into lambda-fold 4-cycle systems

A 4-wheel is a simple graph on 5 vertices with 8 edges, formed by taking a 4-cycle and joining a fifth vertex (the centre of the 4-wheel) to each of the other four vertices. A lambda -fold 4-wheel system of order n is an edge-disjoint decomposition of the complete multigraph lambdaK(n) into 4-wheels. Here, with five isolated possible exceptions when lambda = 2, we give necessary and sufficient conditions for a lambda -fold 4-wheel system of order n to be transformed into a lambda -fold Ccyde system of order n by removing the centre vertex from each 4-wheel, and its four adjacent edges (retaining the 4-cycle wheel rim), and reassembling these edges adjacent to wheel centres into 4-cycles.