Adoptive transfer of gene-engineered CD4+ helper T cells induces potent primary and secondary tumor rejection

Because CD4(+) T cells play a key role in aiding cellular immune responses, we wanted to assess whether increasing numbers of gene-engineered antigen-restricted CD4(+) T cells could enhance an antitumor response mediated by similarly gene-engineered CD8(+) T cells. In this study, we have used retroviral transduction to generate erbB2-reactive mouse T-cell populations composed of various proportions of CD4(+) and CD8(+) cells and then determined the antitumor reactivity of these mixtures. Gene-modified CD4(+) and CD8(+) T cells were shown to specifically secrete Tc1 (T cytotoxic-1) or Tc2 cytokines, proliferate, and lyse erbB2(+) tumor targets following antigen ligation in vitro. In adoptive transfer experiments using severe combined immunodeficient (scid) mice, we demonstrated that injection of equivalent numbers of antigen-specific engineered CD8(+) and CD4(+) T cells led to significant improvement in survival of mice bearing established lung metastases compared with transfer of unfractionated (largely CD8(+)) engineered T cells. Transferred CD4(+) T cells had to be antigen-specific (not just activated) and secrete interferon gamma (IFN-gamma) to potentiate the antitumor effect. Importantly, antitumor responses in these mice correlated with localization and persistence of gene-engineered T cells at the tumor site. Strikingly, mice that survived primary tumor challenge could reject a subsequent re-challenge. Overall, this study has highlighted the therapeutic potential of using combined transfer of antigen-specific gene-modified CD8(+) and CD4(+) T cells to significantly enhance T-cell adoptive transfer strategies for cancer therapy.

Prevalence and correlates of the injection of methadone syrup in Sydney, Australia

A sample of 312 heroin users was interviewed on their injection of methadone syrup. Methadone injecting was widespread, with 52% of subjects having injected methadone syrup, 29% in the preceding six months. Males and females were equally likely to report methadone injecting. Forty per cent Of current methadone injectors reported weekly or more frequent methadone injecting over the preceding six months. A history of methadone injecting was;associated with abscesses and infections in injection sites, having been diagnosed with a venous thrombosis and a history of heroin overdose. Current methadone injectors were in poorer general health, had more injection-related symptoms, higher levels of psychological distress, were more likely to have recently passed on used injecting equipment and to have recently committed criminal acts. Implications for the reduction in the prevalence of methadone injecting and associated harm are discussed.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

The uncharged surface features surrounding the active site of Escherichia coli DsbA are conserved and are implicated in peptide binding

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.

The structure of versutoxin (delta-atracotoxin-Hv1) provides insights into the binding of site 3 neurotoxins to the voltage-gated sodium channel

Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.