55 resultados para Tandem welding
Resumo:
The pathways involved in the maintenance of human embryonic stem (hES) cells remain largely unknown, although some signaling pathways have been identified in mouse embryonic stem (mES) cells. Fibroblast feeder layers are used to maintain the undifferentiated growth of hES cells and an examination of the conditioned media (CM) of human neonatal fibroblasts (HNFs) could provide insights into the maintenance of hES cells. The neonatal foreskin fibroblast line (HNF02) used in this study was shown to have a normal 2n = 46, XY chromosomal complement and to support the undifferentiated growth of the Embryonic Stem Cell International Pte. Ltd.-hES3 cell line. The CM of HNF02 was examined using two-dimensional liquid chromatography-tandem mass spectrometry (2-D LCMS) and two-dimensional electrophoresis (2-DE) followed by matrix-assisted laser desorption/ionization-time of flight tandem mass spectrometry (2-DE/MALDI). A total of 102 proteins were identified, 19 by 2-DE/MALDI, 53 by 2-D LCMS and 30 by both techniques. These proteins were classified into 15 functional groups. Proteins identified in the extracellular matrix and differentiation and growth factor functional categories were considered most likely to be involved in the maintenance of hES cell growth, differentiation and pluripotency as these groups contained proteins involved in a variety of events including cell adhesion, cell proliferation and inhibition of cell proliferation, Writ signaling and inhibition of bone morphogenetic proteins.
Resumo:
A polymorphism of the dopamine transporter gene (DAT1, 10-repeat) is associated with attention-deficit hyperactivity disorder (ADHD) and has been linked to an enhanced response to methylphenidate (MPH). One aspect of the attention deficit in ADHD includes a subtle inattention to left space, resembling that seen after right cerebral hemisphere damage. Since left-sided inattention in ADHD may resolve when treated with MPH, we asked whether left-sided inattention in ADHD was related to DAT1 genotype and the therapeutic efficacy of MPH. A total of 43 ADHD children and their parents were genotyped for the DAT1 30 variable number of tandem repeats polymorphism. The children performed the Landmark Test, a well-validated measure yielding a spatial attentional asymmetry index ( leftward to rightward attentional bias). Parents rated their child's response to MPH retrospectively using a three-point scale ( no, mediocre or very good response). Additionally, parents used a symptom checklist to rate behavior while on and off medication. A within-family control design determined whether asymmetry indices predicted biased transmission of 10-repeat parental DAT1 alleles and/or response to MPH. It was found that left-sided inattention predicted transmission of the 10-repeat allele from parents to probands and was associated with the severity of ADHD symptomatology. Children rated as achieving a very good response to MPH displayed left-sided inattention, while those rated as achieving a poorer response did not. Our results suggest a subgroup of children with ADHD for whom the 10-repeat DAT1 allele is associated with left-sided inattention. MPH may be most efficacious in this group because it ameliorates a DAT1-mediated hypodopaminergic state.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.
Resumo:
The photodegradation of irinotecan (CPT-11), the semisynthetic derivative of the antitumor alkaloid 20(S)-camptothecin, has been investigated. The drug was exposed to laboratory light for up to 5 days in 0.9% saline solution (pH 8.5). Five significant photodegradation products were observed and a high-performance liquid chromatography (HPLC) assay was employed to isolate them from CPT-11 using gradient conditions. The structures were elucidated by nuclear magnetic resonance spectroscopy and tandem mass spectrometry and shown to be the result of extensive modifications of the lactone ring of CPT-11. Three of the compounds were found to belong to the mappicine group of alkaloids. In addition, the effect of light on the stability of CPT-11 in aqueous solutions and biological fluids was also assessed, Potassium phosphate buffers (0.05 M, pH 5.0-8.2) and saline, plasma, urine, and bile solutions containing 20 mu M CPT-11 were equilibrated in the dark for 24 h before being exposed to laboratory light for up to 171 h at ambient temperature. Four of the five identified photodegradation products were observed and quantitated by isocratic HPLC, using a different detection mode (fluorescence) than the one used for gradient elution, In general, CPT-11 was found to be unstable under neutral and alkaline conditions for all solutions investigated, with the exception of bile. We conclude that CPT-11 is photolabile and that care should be taken to protect samples, particularly those intended for the isolation and identification of novel metabolites of CPT-11.
Resumo:
Consider a tandem system of machines separated by infinitely large buffers. The machines process a continuous flow of products, possibly at different speeds. The life and repair times of the machines are assumed to be exponential. We claim that the overflow probability of each buffer has an exponential decay, and provide an algorithm to determine the exact decay rates in terms of the speeds and the failure and repair rates of the machines. These decay rates provide useful qualitative insight into the behavior of the flow line. In the derivation of the algorithm we use the theory of Large Deviations.
Resumo:
The ligand-binding region of the low-density lipoprotein (LDL) receptor is formed by seven N-terminal, imperfect, cysteine-rich (LB) modules. This segment is followed by an epidermal growth factor precursor homology domain with two N-terminal, tandem, EGF-like modules that are thought to participate in LDL binding and recycling of the endocytosed receptor to the cell surface. EGF-A and the concatemer, EGF-AB, of these modules were expressed in Escherichia coli. Correct protein folding of EGF-A and the concatemer EGF-AB was achieved in the presence or absence of calcium ions, in contrast to the LB modules, which require them for correct folding. Homonuclear and heteronuclear H-1-N-15 NMR spectroscopy at 17.6 T was used to determine the three-dimensional structure of the concatemer. Both modules are formed by two pairs of short, anti-parallel beta -strands. In the concatemer, these modules have a fixed relative orientation, stabilized by calcium ion-binding and hydrophobic interactions at the interface. N-15 longitudinal and transverse relaxation rates, and {H-1}-N-15 heteronuclear NOEs were used to derive a model-free description of the backbone dynamics of the molecule. The concatemer appears relatively rigid, particularly near the calcium ion-binding site at the module interface, with an average generalized order parameter of 0.85 +/- 0.11. Some mutations causing familial hypercholesterolemia may now be rationalized. Mutations of D41, D43 and E44 in the EGF-B calcium ion-binding region may affect the stability of the linker and thus the orientation of the tandem modules. The diminutive core also provides little structural stabilization, necessitating the presence of disulfide bonds. The structure and dynamics of EGF-AB contrast with the N-terminal LB modules, which require calcium ions both for folding to form the correct disulfide connectivities and for maintenance of the folded structure, and are connected by highly mobile linking peptides. (C) 2001 Academic Press.
Resumo:
Flash vacuum thermolysis of a large variety of heterocyclic compounds is a useful means of production of ketenes, ketenimines, thioketenes, allenes, iminopropadienones, bis(imino)propadienes, iminopropadienethiones, carbodiimides, isothiocyanates, acetylenes, fulminic acid, nitrile imines and nitrile ylides, nitriles, cyanamides, cyanates, and other compounds, often in preparatively useful yields.
Resumo:
1. An isolated perfused rat liver (IPRL) preparation was used to investigate separately the disposition of the non-steroidal anti-inflammatory drug (NSAID) naproxen (NAP), its reactive acyl glucuronide metabolite (NAG) and a mixture of NAG rearrangement isomers (isoNAG), each at 30 mug NAP equivalents ml(-1) perfusate (n = 4 each group). 2. Following administration to the IPRL, NAP was eliminated slowly in a log-linear manner with an apparent elimination half-life (t(1/2)) of 13.4 +/-4.4 h. No metabolites were detected in perfusate, while NAG was the only metabolite present in bile in measurable amounts (3.9 +/-0.8%, of the dose). Following their administration to the IPRL, both NAG and isoNAG were rapidly hydrolysed (t(1/2) in perfusate=57 +/-3 and 75 +/- 14min respectively). NAG also rearranged to isoNAG in the perfusate. Both NAG and isoNAG were excreted intact in bile (24.6 and 14.8% of the NAG and isoNAG doses, respectively). 3. Covalent NAP-protein adducts in the liver increased as the dose changed from NAP to NAG to isoNAG (0.20 to 0.34 to 0.48% of the doses, respectively). Similarly, formation of covalent NAP-protein adducts in perfusate were greater in isoNAG-dosed perfusions. The comparative results Suggest that isoNAG is a better substrate for adduct formation with liver proteins than NAG.
Resumo:
The complete sequence of the MCIR locus has been assembled, the coding region of the gene is intronless and placed within a 12 kb region flanked by the NULP1 and TUBB4 genes. The immediate promoter region has an E-box site with homology to the M-box consensus known to bind the microphthalmia transcription factor (MITF), however, promoter deletion analysis and transactivation studies have failed to show activation through this element by MITF. Polymorphism within the coding region, immediate 5' promoter region and a variable number tandem repeat (VNTR) minisatellite within the locus have been examined in a collection of Caucasian families and African individuals. Haplotype analysis shows linkage disequilibrium between the VNTR and MCIR coding region red hair variant alleles which can be used to estimate the age of these missense changes. Assuming a mean VNTR mutation rate of 1% and a star phylogeny, we estimate the Arg151Cys variant arose 7500 years before the present day, suggesting these variants may have arisen in the Caucasian population more recently than previously thought. (C) 2001 Published by Elsevier Science B.V.
Resumo:
The male hypermethylated (MHM) region, located near the middle of the short arm of the Z chromosome of chickens, consists of approximately 210 tandem repeats of a BamHI 2.2-kb sequence unit. Cytosines of the CpG dinucleotides of this region are extensively methylated on the two Z chromosomes in the male but much less methylated on the single Z chromosome in the female. The state of methylation of the MHM region is established after fertilization by about the 1-day embryonic stage. The MHM region is transcribed only in the female from the particular strand into heterogeneous, high molecular-mass, non-coding RNA, which is accumulated at the site of transcription, adjacent to the DMRT1 locus, in the nucleus. The transcriptional silence of the MHM region in the male is most likely caused by the CpG methylation, since treatment of the male embryonic fibroblasts with 5-azacytidine results in hypo-methylation and active transcription of this region. In ZZW triploid chickens, MHM regions are hypomethylated and transcribed on the two Z chromosomes, whereas MHM regions are hypermethylated and transcriptionally inactive on the three Z chromosomes in ZZZ triploid chickens, suggesting a possible role of the W chromosome on the state of the MHM region.
Resumo:
The complete nucleotide sequence of the mitochondrial (mt) DNA molecule of the liverfluke, Fasciola hepatica (phylum Platyhelminthes, class Trematoda, family Fasciolidae), was determined, It comprises 14462 bp, contains 12 protein-encoding, 2 ribosomal and 22 transfer RNA genes, and is the second complete flatworm (and the first trematode) mitochondrial sequence to be described in detail. All of the genes are transcribed from the same strand. Of the genes typically found in mitochondrial genomes of eumetazoans, only atp8 is absent. The nad4L and nad4 genes overlap by 40 nt. Most intergenic sequences are very short. Two larger non-coding regions are present. The longer one (817 nt) is located between trnG and cox3 and consists of 8 identical tandem repeats of 85 nt, rich in G and C, followed by 1 imperfect repeat. The shorter non-coding region (187 nt) exhibits no special features and is separated from the longer region by trnG. The gene arrangement resembles that of some other trematodes including the eastern Asian Schistosoma species (and cyclophyllidean cestode species) but it is strikingly different from that of the African schistosomes, represented by Schistosoma mansoni. The genetic code is as inferred previously for flatworms. Transfer RNA genes range in length from 58 to 70 nt, their products producing characteristic 'clover leaf' structures, except for tRNA(S-VON) and tRNA(S-AGN) lacking the DHU arm.
Resumo:
The development of cropping systems simulation capabilities world-wide combined with easy access to powerful computing has resulted in a plethora of agricultural models and consequently, model applications. Nonetheless, the scientific credibility of such applications and their relevance to farming practice is still being questioned. Our objective in this paper is to highlight some of the model applications from which benefits for farmers were or could be obtained via changed agricultural practice or policy. Changed on-farm practice due to the direct contribution of modelling, while keenly sought after, may in some cases be less achievable than a contribution via agricultural policies. This paper is intended to give some guidance for future model applications. It is not a comprehensive review of model applications, nor is it intended to discuss modelling in the context of social science or extension policy. Rather, we take snapshots around the globe to 'take stock' and to demonstrate that well-defined financial and environmental benefits can be obtained on-farm from the use of models. We highlight the importance of 'relevance' and hence the importance of true partnerships between all stakeholders (farmer, scientists, advisers) for the successful development and adoption of simulation approaches. Specifically, we address some key points that are essential for successful model applications such as: (1) issues to be addressed must be neither trivial nor obvious; (2) a modelling approach must reduce complexity rather than proliferate choices in order to aid the decision-making process (3) the cropping systems must be sufficiently flexible to allow management interventions based on insights gained from models. The pro and cons of normative approaches (e.g. decision support software that can reach a wide audience quickly but are often poorly contextualized for any individual client) versus model applications within the context of an individual client's situation will also be discussed. We suggest that a tandem approach is necessary whereby the latter is used in the early stages of model application for confidence building amongst client groups. This paper focuses on five specific regions that differ fundamentally in terms of environment and socio-economic structure and hence in their requirements for successful model applications. Specifically, we will give examples from Australia and South America (high climatic variability, large areas, low input, technologically advanced); Africa (high climatic variability, small areas, low input, subsistence agriculture); India (high climatic variability, small areas, medium level inputs, technologically progressing; and Europe (relatively low climatic variability, small areas, high input, technologically advanced). The contrast between Australia and Europe will further demonstrate how successful model applications are strongly influenced by the policy framework within which producers operate. We suggest that this might eventually lead to better adoption of fully integrated systems approaches and result in the development of resilient farming systems that are in tune with current climatic conditions and are adaptable to biophysical and socioeconomic variability and change. (C) 2001 Elsevier Science Ltd. All rights reserved.