Isolation of genotype- and chromosome-specific DNA markers in a biotype of Colletotrichum gloeosporioides using random amplified polymorphic DNA analysis

Genetic markers that distinguish fungal genotypes are important tools for genetic analysis of heterokaryosis and parasexual recombination in fungi. Random amplified polymorphic DNA (RAPD) markers that distinguish two races of biotype B of Colletotrichum gloeosporioides infecting the legume Stylosanthes guianensis were sought. Eighty-five arbitrary oligonucleotide primers were used to generate 895 RAPD bands but only two bands were found to be specifically amplified from DNA of the race 3 isolate. These two RAPD bands were used as DNA probes and hybridised only to DNA of the race 3 isolate. Both RAPD bands hybridised to a dispensable 1.2 Mb chromosome of the race 3 isolate. No other genotype-specific chromosomes or DNA sequences were identified in either the race 2 or race 3 isolates. The RAPD markers hybridised to a 2 Mb chromosome in all races of the genetically distinct biotype A pathogen which infects other species of Stylosanthes as well as S. guianensis. The experiments indicate that RAPD analysis is a potentially useful tool for obtaining genotype-and chromosome-specific DNA probes in closely related isolates of one biotype of this fungal pathogen.

Phosphorylation of the C-terminal sites of human p53 reduces non-sequence-specific DNA binding as modeled with synthetic peptides

Phosphorylation of the tumor suppressor p53 is generally thought to modify the properties of the protein in four of its five independent domains. We used synthetic peptides to directly study the effects of phosphorylation on the non-sequence-specific DNA binding and conformation of the C-terminal, basic domain. The peptides corresponded to amino acids 361-393 and were either nonphosphorylated or phosphorylated at the protein kinase C (PKC) site, Ser378, or the casein kinase II (CKII) site, Ser392, or bis-phosphorylated on both the PKC and the CKII sites. A fluorescence polarization analysis revealed that either the recombinant p53 protein or the synthetic peptides bound to two unrelated target DNA fragments. Phosphorylation of the peptide at the PKC or the CKII sites clearly decreased DNA binding, and addition of a second phosphate group almost completely abolished binding. Circular dichroism spectroscopy showed that the peptides assumed identical unordered structures in aqueous solutions. The unmodified peptide, unlike the Ser378 phosphorylated peptide, changed conformation in the presence of DNA. The inherent ability of the peptides to form an alpha-helix could be detected when circular dichroism and nuclear magnetic resonance spectra were: taken in trifluoroethanol-water mixtures. A single or double phosphorylation destabilized the helix around the phosphorylated Ser378 residue but stabilized the helix downstream in the sequence.

Site-directed mutants of RTP of Bacillus subtilis and the mechanism of replication fork arrest

DNA replication fork arrest during the termination phase of chromosome replication in Bacillus subtilis is brought about by the replication terminator protein (RTP) bound to specific DNA terminator sequences (Tev sites) distributed throughout the terminus region. An attractive suggestion by others was that crucial to the functioning of the RTP-Ter complex is a specific interaction between RTP positioned on the DNA and the helicase associated with the approaching replication fork. Ln support of this was the behaviour of two site-directed mutants of RTP. They appeared to bind Ter DNA normally but were ineffective in fork arrest as ascertained by in vitro Escherichia coli DnaB helicase and replication assays. We describe here a system for assessing the fork-arrest behaviour of RTP mutants in a bona fide in vivo assay in B. subtilis. One of the previously studied mutants, RTP.Y33N, was non-functional in fork arrest in vivo, as predicted. But through extensive analyses, this RTP mutant was shown to be severely defective in binding to Ter DNA, contrary to expectation. Taken in conjunction with recent findings on the other mutant (RTP.E30K), it is concluded that there is as yet no substantive evidence from the behaviour of RTP mutants to support the Rm-helicase interaction model for fork arrest. In an extension of the present work on RTP.Y33N, we determined the dissociation rates of complexes formed by wild-type (wt) RTP and another RTP mutant with various terminator sequences. The functional wtRTP-TerI complex was quite stable (half-life of 182 minutes), reminiscent of the great stability of the E. coli Tus-Ter complex. More significant were the exceptional stabilities of complexes comprising wtRTP and an RTP double-mutant (E39K.R42Q) bound to some particular terminator sequences. From the measurement of in vivo fork-arrest activities of the various complexes, it is concluded that the stability (half-life) of the whole RTP-Ter complex is not the overriding determinant of arrest, and that the RTP-Ter complex must be actively disrupted, or RTP removed, by the action of the approaching replication fork. (C) 1999 Academic Press.

Development of P2 olfactory glomeruli in P2-internal ribosome entry site-tau-lacZ transgenic mice

Primary olfactory neurons project their axons to the olfactory bulb, where they terminate in discrete loci called glomeruli. All neurons expressing the same odorant receptor appear to terminate in a few glomeruli in each olfactory bulb. In the P2-IRES-tau-LacZ line of transgenic mice, LacZ is expressed in the perikarya and axons of primary olfactory neurons that express the P2 odorant receptor. In the present study, we examined the developmental appearance of P2 neurons, the topographical targeting of P2 axons, as well as the formation of P2 glomeruli in the olfactory bulb. P2 axons were first detected in the olfactory nerve fiber layer at embryonic day 14.5 (E14.5), and by E15.5 these axons terminated in a broad locus in the presumptive glomerular layer. During the next 5 embryonic days, the elongated cluster of axons developed into discrete glomerulus-like structures. In many cases, glomeruli appeared as pairs, which were initially connected by a fascicle of P2 axons. This connection was lost by postnatal day 7.5, and double glomeruli at the same locus were observed in 85% of adult animals. During the early postnatal period, there was considerable mistargeting of P2 axons. In some cases P2 axons entered inappropriate glomeruli or continued to grow past the glomerular layer into the deeper layers of the olfactory bulb. These aberrant axons were not observed in adult animals. These results indicate that olfactory axons exhibit errors while converging onto a specific glomerulus and suggest that guidance cues may be diffusely distributed at target sites in the olfactory bulb.

Chromosomal fragile site FRA16D and DNA instability in cancer

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not Set clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998), Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

A multi-sectorial committee in directing HIV/AIDS-specific interventions in the occupational setting: An example from South Africa

We present a descriptive analysis of a mechanism to coordinate and implement human immunodeficiency virus (HIV) prevention and care in the occupational setting. The mechanism we describe is a multidisciplinary committee composed of stakeholders in the occupational health environment including unions, management, medical researchers, and medical personnel. The site chosen for the analysis was a South African sugar mill in rural KwaZulu-Natal. The factory is situated in an area of high HIV seroprevalence and has a workforce of 400 employees. The committee was initiated to coordinate a combined prevention-care initiative. The issues that were important in the formation of the committee included confidentiality, trust, and the traditional roles of the stakeholder relationships. When these points were addressed through the focus on a common goal, the committee was able to function in its role as a coordinating body. Central to this success was the inclusion of all stakeholders in the process, including those with traditionally opposing, interests and legitimacy conferred by the stakeholders. This committee was functionally effective and demonstrated the benefit of a freestanding committee dedicated to addressing HIV/acquired immune deficiency syndrome (AIDS) issues. We describe the implementation and feasibility of a multisectoral committee in directing HIV/AIDS initiatives in the occupational setting in rural South Africa.

Quantification of prolactin-releasing peptide (PrRP) mRNA expression in specific brain regions of the rat during the oestrous cycle and in lactation

Real-time Taqman(TM) RT-PCR was used to make quantitative comparisons of the levels of PrRP mRNA expression in micropunch brain samples from rats at different stages of the oestrous cycle and in lactation. The nucleus of the solitary tract and ventrolateral reticular nuclei of the medulla oblongata contained significantly (P < 0.05) greater levels of PrRP mRNA than any hypothalamic region. Within the hypothalamus, the highest level of PrRP expression was localised to the dorsomedial aspect of the ventromedial hypothalamus. All other hypothalamic regions exhibited significantly (P < 0.05) lower levels of expression, including the rostral and caudal dorsomedial hypothalamus. Very low levels of PrRP expression were observed in the arcuate nucleus, paraventricular nucleus, medial preoptic nucleus and ventrolateral aspect of the ventromedial hypothalamus. No significant changes in PrRP expression were noted in any sampled region between proestrus, oestrus or dioestrus. Similarly, PrRP expression in hypothalamic regions did not differ between lactating and non-lactating (dioestrous) animals. During validation of RT-PCR techniques we cloned and sequenced a novel splice variant of PrRP from the hypothalamus. This variant arises from alternative splicing of the donor site within exon 2, resulting in an insert of 64 base pairs and shift in the-codon:reading frame with the introduction of an early stop codon. In the hypothalamus and brainstem, mRNA expression of the variant was restricted to regions that expressed PrRP. These results suggest that PrRP expression in the hypothalamus may be more Widespread than previously reported. However, the relatively low level of PrRP in the hypothalamus and the lack of significant changes in expression during the oestrous cycle and lactation provides further evidence that PrRP is unlikely to be involved in the regulation of prolactin, secretion. (C) 2003 Elsevier Science B.V. All rights reserved.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

The GRIP domain is a specific targeting sequence for a population of trans-Golgi network derived tubulo-vesicular carriers

Vesicular carriers for intracellular transport associate with unique sets of accessory molecules that dictate budding and docking on specific membrane domains. Although many of these accessory molecules are peripheral membrane proteins, in most cases the targeting sequences responsible for their membrane recruitment have yet to be identified. We have previously defined a novel Golgi targeting domain (GRIP) shared by a family of coiled-coil peripheral membrane Golgi proteins implicated in membrane trafficking. We show here that the docking site for the GRIP motif of p230 is a specific domain of Golgi. membranes. By immunoelectron microscopy of HeLa cells stably expressing a green fluorescent protein (GFP)-p230(GRIP) fusion protein, we show binding specifically to a subset of membranes of the trans-Golgi network (TGN). Real-time imaging of live HeLa cells revealed that the GFP-p230(GRIP) was associated with highly dynamic tubular extensions of the TGN, which have the appearance and behaviour of transport carriers. To further define the nature of the GRIP membrane binding site, in vitro budding assays were performed using purified rat liver Golgi membranes and cytosol from GFP-p230(GRIP) transfected cells. Analysis of Golgi-derived vesicles by sucrose gradient fractionation demonstrated that GFP-p230(GRIP) binds to a specific population of vesicles distinct from those labelled for beta -COP or gamma -adaptin. The GFP-p230(GRIP) fusion protein is recruited to the same vesicle population as full-length p230, demonstrating that the GRIP domain is solely proficient as a targeting signal for membrane binding of the native molecule. Therefore, p230 GRIP is a targeting signal for recruitment to a highly selective membrane attachment site on a specific population of trans-Golgi network tubulovesicular carriers.

Solution structure of CnErg1 (Ergtoxin), a HERG specific scorpion toxin

The three-dimensional structure of chemically synthesized CnErg1 (Ergtoxin), which specifically blocks HERG (human ether-a-go-go-related gene) K+ channels, was determined by nuclear magnetic resonance spectroscopy. CnErg1 consists of a triple-stranded beta-sheet and an a-helix, as is typical of K+ channel scorpion toxins. The peptide structure differs from the canonical structures in that the first beta-strand is shorter and is nearer to the second beta-strand rather than to the third beta-strand on the C-terminus. There is also a large hydrophobic patch on the surface of the toxin, surrounding a central lysine residue, Lys13. We postulate that this hydrophobic patch is likely to form part of the binding surface of the toxin. (C) 2003 Published by Elsevier Science B.V. on behalf of the Federation of European Biochemical Societies.