63 resultados para Site AP
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.
Resumo:
The DNA-binding activities of AP-1 and Egr proteins were investigated in nuclear extracts of rat brain regions during ethanol withdrawal. Both DNA-binding activities were transiently elevated in the hippocampus and cerebellum 16 h after withdrawal. In the cerebral cortex, AP-1 and Egr DNA-binding activities increased at 16 h and persisted until 32 and 72 h, respectively. The AP-1 DNA-binding activities in all regions at all times after withdrawal were composed of FosB, c-Jun, JunB, and JunD. c-Fos was detected at all times in the cerebral cortex, at 16 h only in the hippocampus, and from 16 to 72 h in the cerebellum. Withdrawal severity did not affect the composition of the AP-1 DNA-binding activities. Two Egr DNA-binding activities were present in the cortex and hippocampus. The faster-migrating complex predominated in hippocampus, and only the slower-migrating complex (identified as Egr-1) was present in the cerebellum. The increase in DNA-binding activity of immediate early gene-encoded transcription factors supports their proposed role in initiating a cascade of altered gene expression underlying the long-term neuronal response to ethanol withdrawal.
Resumo:
Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.