Chemical synthesis, antibacterial activity and conformation of diptericin, an 82-mer peptide originally isolated from insects

The small amounts of antibacterial peptides that can be isolated from insects do not allow detailed studies of their range of activity, side-chain sugar requirements, or their conformation, factors that frequently play roles in the mode of action. In this paper, we report the solid-phase step-by-step synthesis of diptericin, an 82-mer peptide, originally isolated from Phormia terranovae. The unglycosylated peptide was purified to homogeneity by conventional reversed-phase high performance liquid chromatography, and its activity spectrum was compared to that Of synthetic unglycosylated drosocin, which shares strong sequence homology with diptericin's N-terminal domain. Diptericin appeared to have antibacterial activity:for only a limited number of Gram-negative bacteria. Diptericin's submicromolar potency against Escherichia coli strains indicated that, in a manner similar to drosocin, the presence of the carbohydrate side chain is not,necessary to kill bacteria. Neither the N-terminal, drosocin-analog fragment, nor the C-terminal, glycine-rich attacin-analog region was active against any of the bacterial strains studied, regardless of whether the Gal-GalNAc disaccharide units were attached. This suggested that the active site of diptericin fell outside the drosocin or attacin homology domains. In addition, the conformation of diptericin did not seem to play a role in the antibacterial activity, as was demonstrated by the complete lack of ordered structure by two-dimensional nuclear magnetic resonance spectroscopy and circular dichroism. Diptericin completely killed bacteria within I h, considerably faster than drosocin and the attacins; unlike some other, fast-acting antibacterial peptides, diptericin did not lyse normal mammalian cells. Taken together, these data suggest diptericin does not belong to any known class of antibacterial peptides.

Modelling socially optimal land allocations for sugar cane growing in North Queensland: a linked mathematical programming and choice modelling study

A modelling framework is developed to determine the joint economic and environmental net benefits of alternative land allocation strategies. Estimates of community preferences for preservation of natural land, derived from a choice modelling study, are used as input to a model of agricultural production in an optimisation framework. The trade-offs between agricultural production and environmental protection are analysed using the sugar industry of the Herbert River district of north Queensland as an example. Spatially-differentiated resource attributes and the opportunity costs of natural land determine the optimal tradeoffs between production and conservation for a range of sugar prices.

The Las Campanas/AAT rich cluster survey - I. Precision and reliability of the photometric catalogue

The Las Campanas Observatory and Anglo-Australian Telescope Rich Cluster Survey (LARCS) is a panoramic imaging and spectroscopic survey of an X-ray luminosity-selected sample of 21 clusters of galaxies at 0.07 < z < 0.16. Charge-coupled device (CCD) imaging was obtained in B and R of typically 2 degrees wide regions centred on the 21 clusters, and the galaxy sample selected from the imaging is being used for an on-going spectroscopic survey of the clusters with the 2dF spectrograph on the Anglo-Australian Telescope. This paper presents the reduction of the imaging data and the photometric analysis used in the survey. Based on an overlapping area of 12.3 deg(2) we compare the CCD-based LARCS catalogue with the photographic-based galaxy catalogue used for the input to the 2dF Galaxy Redshift Survey (2dFGRS) from the APM, to the completeness of the GRS/APM catalogue, b(J) = 19.45. This comparison confirms the reliability of the photometry across our mosaics and between the clusters in our survey. This comparison also provides useful information concerning the properties of the GRS/APM. The stellar contamination in the GRS/APM galaxy catalogue is confirmed as around 5-10 per cent, as originally estimated. However, using the superior sensitivity and spatial resolution in the LARCS survey evidence is found for four distinct populations of galaxies that are systematically omitted from the GRS/APM catalogue. The characteristics of the 'missing' galaxy populations are described, reasons for their absence examined and the impact they will have on the conclusions drawn from the 2dF Galaxy Redshift Survey are discussed.

The Las Campanas/AAT Rich Cluster Survey - II. The environmental dependence of galaxy colours in clusters at z similar to 0.1

We present a photometric investigation of the variation in galaxy colour with environment in 11 X-ray-luminous clusters at 0.07 less than or equal to z less than or equal to 0.16 taken from the Las Campanas/AAT Rich Cluster Survey. We study the properties of the galaxy populations in individual clusters, and take advantage of the homogeneity of the sample to combine the clusters together to investigate weaker trends in the composite sample. We find that modal colours of galaxies lying on the colour-magnitude relation in the clusters become bluer by d(B - R)/dr(p) = -0.022 +/- 0.004 from the cluster core out to a projected radius of r(p) = 6 Mpc, further out in radius than any previous study. We also examine the variation in modal galaxy colour with local galaxy density, 2, for galaxies lying close to the colour-magnitude relation, and find that the median colour shifts bluewards by d(B - R)/d log(10)(Sigma) = -0.076 +/- 0.009 with decreasing local density across three orders of magnitude. We show that the position of the red envelope of galaxies in the colour-magnitude relation does not vary as a function of projected radius or density within the clusters, suggesting that the change in the modal colour results from an increasing fraction of bluer galaxies within the colour-magnitude relation, rather than a change in the colours of the whole population. We show that this shift in the colour-magnitude relations with projected radius and local density is greater than that expected from the changing morphological mix based on the local morphology-density relation. We therefore conclude that we are seeing a real change in the properties of galaxies on the colour-magnitude relation in the outskirts of clusters. The simplest interpretation of this result (and similar constraints in local clusters) is that an increasing fraction of galaxies in the lower density regions at large radii within clusters exhibit signatures of star formation in the recent past, signatures which are not seen in the evolved galaxies in the highest density regions.

Molecular diversity through sugar scaffolds

Monosaccharides provide an excellent platform to tailor molecular diversity by appending desired substituents at selected positions around the sugar scaffold. The presence of five functionalized and stereo-controlled centres on the sugar scaffolds gives the chemist plenty of scope to custom design molecules to a pharmacophore model. This review focuses on the peptidomimetic developments in this area, as well as the concept of tailoring structural and functional diversity in a library using carbohydrate scaffolds and how this can lead to increased hit rates and rapid identification of leads, which has promising prospects for drug development.

Geospatial clustering in data-rich environments: Features and issues

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Mechanisms of biocontrol by Pantoea dispersa of sugar cane leaf scald disease caused by Xanthomonas albilineans

Albicidins, a family of phytotoxins and antibiotics produced by Xanthomonas albilineans, are important in sugar cane leaf scald disease development. The albicidin detoxifying bacterium Pantoea dispersa (syn. Erwinia herbicola) SB1403 provides very effective biocontrol against leaf scald disease in highly susceptible sugar cane cultivars. The P. dispersa gene (albD) for enzymatic detoxification of albicidin has recently been cloned and sequenced. To test the role of albicidin detoxification in biocontrol of leaf scald disease, albD was inactivated in P. dispersa by site-directed mutagenesis. The mutants, which were unable to detoxify albicidin, were less resistant to the toxin and less effective in biocontrol of leaf scald disease than their parent strain. This indicates that albicidin detoxification contributes to the biocontrol capacity of P. dispersa against X. albilineans. Rapid growth and ability to acidify media are other characteristics likely to contribute to the competitiveness of P. dispersa against X. albilineans at wound sites used to invade sugar cane.

The myosin-I-binding protein Acan125 binds the SH3 domain and belongs to the superfamily of leucine-rich repeat proteins

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.