89 resultados para SPLICE DONOR SITE


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The structures of diaqua(1,7-dioxa-4-thia-10-azacyclododecane)nickel dinitrate, [Ni(C8H17NO2S)(H2O)(2)](NO3)(2), (I), bis(nitrato-O,O')(1,4,7-trioxa-10-azacyclododecane)mercury, [Hg(NO3)(2)(C8H17NO3)], (II), and aqua(nitrato-O)(1-oxa-4,7,10-triazacyclododecane)copper nitrate, [Cu(NO3)(C8H19N3O)(H2O)]NO3, (III), reveal each macrocycle binding in a tetradentate manner. The conformations of the ligands in (I) and (III) are the same and distinct from that identified for (II). These differences are in agreement with molecular-mechanics predictions of ligand conformation as a function of metal-ion size.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

NMR solution structures are reported for two mutants (K16E, K16F) of the soluble amyloid beta peptide A beta(1-28). The structural effects of these mutations of a positively charged residue to anionic and hydrophobic residues at the alpha-secretase cleavage site (Lys16-Leu17) were examined in the membrane-simulating solvent aqueous SDS micelles. Overall the three-dimensional structures were similar to that for the native A beta(1-28) sequence in that they contained an unstructured N-terminus and a helical C-terminus. These structural elements are similar to those seen in the corresponding regions of full-length A beta peptides A beta(1-40) and A beta(1-42), showing that the shorter peptides are valid model systems. The K16E mutation, which might be expected to stabilize the macrodipole of the helix, slightly increased the helix length (residues 13-24) relative to the K16F mutation, which shortened the helix to between residues 16 and 24. The observed sequence-dependent control over conformation in this region provides an insight into possible conformational switching roles of mutations in the amyloid precursor protein from which A beta peptides are derived. In addition, if conformational transitions from helix to random coil to sheet precede aggregation of A beta peptides in vivo, as they do in vitro, the conformation-inducing effects of mutations at Lys16 may also influence aggregation and fibril formation. (C) 2000 Academic Press.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The 3-dimensionaI structure determination of rat phenylalanine hydroxylase (PAH) has identified potentially important amino acids lining the active site cleft with the majority of these having hydrophobic side-chains including several with aromatic side chains. Here we have analyzed the effect on rat PAH enzyme kinetics of in vitro mutagenesis of a number of these amino acids lining the PAH active site. Mutation of F299, Y324, F331, and Y343 caused a significant decrease in enzyme activity but no change in the K-m for substrate or cofactor. me conclude that these aromatic residues are essential for activity but are not significantly involved in binding of the substrate or cofactor. in contrast the PAH mutant, S349T, showed an 18-fold increase in K-m for phenylalanine, showing the first functional evidence that this residue was binding at or near the phenylalanine binding site. This confirms the recently published model for the binding of phenylalanine to the PAH active site that postulated S349 interacts with the amino group on the main chain of the phenylalanine molecule. This result differs with that found for the equivalent mutation (S395T), in the closely related tyrosine hydroxylase, which had no effect on substrate K-m, showing that while the architecture of the two active sites are very similar the amino acids that bind to the respective substrates are different. (C) 2000 Academic Press.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We consider the electronic properties of layered molecular crystals of the type theta -D(2)A where A is an anion and D is a donor molecule such as bis-(ethylenedithia-tetrathiafulvalene) (BEDT-TTF), which is arranged in the theta -type pattern within the layers. We argue that the simplest strongly correlated electron model that can describe the rich phase diagram of these materials is the extended Hubbard model on the square lattice at one-quarter filling. In the limit where the Coulomb repulsion on a single site is large, the nearest-neighbor Coulomb repulsion V plays a crucial role. When V is much larger than the intermolecular hopping integral t the ground state is an insulator with charge ordering. In this phase antiferromagnetism arises due to a novel fourth-order superexchange process around a plaquette on the square lattice. We argue that the charge ordered phase is destroyed below a critical nonzero value V, of the order of t. Slave-boson theory is used to explicitly demonstrate this for the SU(N) generalization of the model, in the large-N limit. We also discuss the relevance of the model to the all-organic family beta-(BEDT-TTF)(2)SF5YSO3 where Y=CH2CF2, CH2, CHF.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The reactions of mercury(II) with the mixed donor encapsulating ligands 3,6,16-trithia-6,11,19-triazabicyclo[6.6.6]icosane (AMN(3)S(3)sar) and 1-amino-8-methyl-6,19-dithia-3,10,13,16-tetraazabicyclo[6.6.6]icosane (AMN(4)S(2)sar) have been studied. NMR ligand-ligand competition experiments with the ligands 1,4,8,11-tetraazaeyclotetradecane ([14]aneN(4)), 1-thia-4,7,10-triazacyclododecane ([12]aneN(3)S) and ethylenediaminetetraacetic acid (EDTA) with AMN(3)S(3)sar and Hg(II) indicated that [14]aneN(4) would be an appropriate competing ligand for the, determination of the Hg(II) stability constant. Calculations indicated the ratio of concentrations of AMN3S3sar, [14]aneN(4) and Hg(II) required for the determination of the stability constant ranged from 1:1:1 to 1:5:1. Refinement of the titration curves yielded log(10)K[Hg(AMN(3)S(3)sar)](2+) = 17.7. A similar competition titration resulted in the determination of the stability constant for the AMN(4)S(2)sar system as log(10)K[Hg(AMN(4)S(2)sar)](2+) = 19.5. The observed binding constants for the mixed N/S donor systems and the hexaaza analogues sar (3,6,10,13,16,19-hexaazabicyclo [6.6.6]icosane) and diamsar (1,8-diamino-3,6,10,13,16,19 -hexazabicyclo [6.6.6] icosane (log(10)K-[Hg(diamsar)](2+) = 26.4; log(10)K[Hg(sar)](2+) = 28.1) differ by approximately ten orders of magnitude. The difference is ascribed not to a cryptate effect but to a mismatch in the Hg-N and Hg-S bond lengths in the N/S systems.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Syphilis remains a significant cause of preventable perinatal death in developing countries with many women remaining untested and thus untreated. Syphilis testing in the clinic (on-site testing) may be a useful strategy to overcome this. We studied the impact of on-site syphilis testing on treatment delays and rates, and perinatal mortality. Methods: We conducted a cluster randomised controlled trial among seven pairs of primary healthcare clinics in rural South Africa, comparing on-site testing complemented by laboratory confirmation versus laboratory testing alone. Intervention clinics used the on-site test conducted by primary care nurses, with results and treatment available within an hour. Control clinics sent blood samples to the provincial laboratory, with results returned 2 weeks later. Results: Of 7134 women seeking antenatal care with available test results, 793 (11.1%) tested positive for syphilis. Women at intervention clinics completed treatment 16 days sooner on average (95% confidence interval: 11 to 21), though there was no significant difference in the proportion receiving adequate treatment at intervention (64%) and control (69%) clinics. There was also no significant difference in the proportion experiencing perinatal loss (3.3% v 5.1%; adjusted risk difference: -0.9%; 95% Cl -4.4 to 2.7). Conclusions: Despite reducing treatment delays, the addition of on-site syphilis testing to existing laboratory testing services did not lead to higher treatment rates or reduce perinatal mortality. However on-site testing for syphilis may remain an important option for improving antenatal care in settings where laboratory facilities are not available.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The crystal structure of six functionally-distinct enzymes of the DMSO reductase family of molybdenum enzymes has revealed that the tertiary structure of the polypeptide that binds the bis(MGD)Mo cofactor is highly conserved. Differences in the catalytic properties of enzymes of this family are almost certainly dependent upon differences in the structure ofthe MO active site. In DMSO reductase from Rhodobacter species tryptophan- 116 (W 116) hydrogen-bonds to an 0x0 group coordinated to the MO ion. In addition a second amino acid side chain from tyrosine-114 (Y 114) is in close proximity to the 0x0 group. We have investigated the role of Y 114 and W 116 in DMSO reductase using site-directed mutagenesis,

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The synthesis of the hexadentate ligand 2,2,9,9-tetra(methyleneamine)-4,7-dithiadecane (EtN(4)S(2)amp) is reported. The ligand is of a type in which bifurcations of the chain occur at atoms other than donor atoms. The cobalt(III) complex [Co(EtN(4)S(2)amp)](3+) (1) was isolated and characterized. The synthetic methodology also results in a number of by-products, notably 2,9,9-tris(methyleneamine)-9-methylenehydroxy-4,7-dithiadecane (Et(HO)N(3)S(2)amp) and an eleven-membered pendant arm macrocyclic ligand 6,10-dimethyl-6,10-bis(methyleneamine)-1,4-dithia-8-azaacycloundec-7- ene (dmatue). The complexes [Co(Et(HO)N(3)S(2)amp)](3+) (2), in which the alcohol is coordinated to the metal ion, and [Co(dmatue)Cl](2+) (4) were isolated and characterized. Et(HO)N(3)S(2)amp also undergoes complexation with cobalt(III) to produce two isomers endo-[Co(Et(HO) N(3)S(2)amp)Cl](2+) (endo-3) and exo-[Co(Et(HO) N(3)S(2)amp)Cl](2+) (exo-3), both with an uncoordinated alcohol group. endo- 3 has the alcohol positioned cis, and exo-3 trans, to the sixth metal coordination site. Reaction of 1 with isobutyraldehyde, paraformaldehyde and base in dimethylformamide results in the encapsulated complex [Co(1,5,5,9,13,13-hexamethyl-18,21-dithia-3,7,11,15-tetraazabicyclo[7.7.6]docosa- 3,14-diene)](ClO4)(3) . 2H(2)O ([Co(Me(6)docosadieneN(4)S(2))](3+) ( 5). All complexes have been characterized by single crystal X-ray study. The low-temperature (11 K) absorption spectrum of 1 has been measured in Nafion films with spin-allowed (1)A(1g) --> T-1(1g) and (1)A(1g) --> T-1(2g) and spin forbidden (1)A(1g) --> T-3(1g) and (1)A(1g) --> T-3(2g) bands observed. The octahedral ligand-field parameters were determined (10Dq = 22570 cm(-1), B = 551 cm(-1); C = 3500 cm(-1)). For 5 10Dq and B were determined (20580 cm(-1); 516 cm(-1), respectively) and compared with those for similar expanded cavity complexes [Co(Me(8)tricosatrieneN(6))](3+) and [Co(Me(5)tricosatrieneN(6))](3+).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Many drugs and chemicals found in the environment are either detoxified by N-acetyltransferase 1 (NAT1, EC 2.3.1.5) and eliminated from the body or bioactivated to metabolites that have the potential to cause toxicity and/or cancer. NAT1 activity in the body is regulated by genetic polymorphisms as well as environmental factors such as substrate-dependent down-regulation and oxidative stress. Here we report the molecular mechanism for the low protein expression from mutant NAT1 alleles that gives rise to the slow acetylator phenotype and show that a similar process accounts for enzyme down-regulation by NAT1 substrates. NAT1 allozymes NAT1 14, NAT1 15, NAT1 17, and NAT1 22 are devoid of enzyme activity and have short intracellular half-lives (similar to4 h) compared with wild-type NAT1 4 and the active allozyme NAT1 24. The inactive allozymes are unable to be acetylated by cofactor, resulting in ubiquitination and rapid degradation by the 26 S proteasome. This was confirmed by site-directed mutagenesis of the active site cysteine 68. The NAT1 substrate p-aminobenzoic acid induced ubiquitination of the usually stable NAT1 4, leading to its rapid degradation. From this study, we conclude that NAT1 exists in the cell in either a stable acetylated state or an unstable non-acetylated state and that mutations in the NAT1 gene that prevent protein acetylation produce a slow acetylator phenotype.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We theoretically study the Hilbert space structure of two neighboring P-donor electrons in silicon-based quantum computer architectures. To use electron spins as qubits, a crucial condition is the isolation of the electron spins from their environment, including the electronic orbital degrees of freedom. We provide detailed electronic structure calculations of both the single donor electron wave function and the two-electron pair wave function. We adopted a molecular orbital method for the two-electron problem, forming a basis with the calculated single donor electron orbitals. Our two-electron basis contains many singlet and triplet orbital excited states, in addition to the two simple ground state singlet and triplet orbitals usually used in the Heitler-London approximation to describe the two-electron donor pair wave function. We determined the excitation spectrum of the two-donor system, and study its dependence on strain, lattice position, and interdonor separation. This allows us to determine how isolated the ground state singlet and triplet orbitals are from the rest of the excited state Hilbert space. In addition to calculating the energy spectrum, we are also able to evaluate the exchange coupling between the two donor electrons, and the double occupancy probability that both electrons will reside on the same P donor. These two quantities are very important for logical operations in solid-state quantum computing devices, as a large exchange coupling achieves faster gating times, while the magnitude of the double occupancy probability can affect the error rate.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).