Proteasomal degradation of N-acetyltransferase 1 is prevented by acetylation of the active site cysteine - A mechanism for the slow acetylator phenotype and substrate-dependent down-regulation

Many drugs and chemicals found in the environment are either detoxified by N-acetyltransferase 1 (NAT1, EC 2.3.1.5) and eliminated from the body or bioactivated to metabolites that have the potential to cause toxicity and/or cancer. NAT1 activity in the body is regulated by genetic polymorphisms as well as environmental factors such as substrate-dependent down-regulation and oxidative stress. Here we report the molecular mechanism for the low protein expression from mutant NAT1 alleles that gives rise to the slow acetylator phenotype and show that a similar process accounts for enzyme down-regulation by NAT1 substrates. NAT1 allozymes NAT1 14, NAT1 15, NAT1 17, and NAT1 22 are devoid of enzyme activity and have short intracellular half-lives (similar to4 h) compared with wild-type NAT1 4 and the active allozyme NAT1 24. The inactive allozymes are unable to be acetylated by cofactor, resulting in ubiquitination and rapid degradation by the 26 S proteasome. This was confirmed by site-directed mutagenesis of the active site cysteine 68. The NAT1 substrate p-aminobenzoic acid induced ubiquitination of the usually stable NAT1 4, leading to its rapid degradation. From this study, we conclude that NAT1 exists in the cell in either a stable acetylated state or an unstable non-acetylated state and that mutations in the NAT1 gene that prevent protein acetylation produce a slow acetylator phenotype.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Risk factors for post-stroke depression

Objective. To examine possible risk factors in post-stroke depression (PSD) other than site of lesion in the brain Data sources. 191 first-ever stroke patients were examined physically shortly after their stroke and examined psychiatrically and physically 4 months post-stroke. Setting. A geographically defined segment of the metropolitan area of Perth, Western Australia, from which all strokes over a course of 18 months were examined (the Perth Community Stroke Study). Measures. Psychiatric Assessment Schedule, Mini Mental State Examination, Barthel Index, Frenchay Activities Index, physical illness and sociodemographic data were collected. Post-stroke depression (PSD) included both major depression and minor depression (dysthymia without the 2-year time stipulation) according to DSM-III (American Psychiatric Association) criteria. Patients depressed at the time of the stroke were excluded. Patients. 191 first-ever stroke patients, 111M, 80F, 28% had PSD, 17% major and 11% minor depression. Results. Significant associations with PSD at 4 months were major functional impairment, living in a nursing home, being divorced and having a high pre-stroke alcohol intake (M only). There was no significant association with age, sex, social class, cognitive impairment or pre-stroke physical illness. Conclusion. Results favoured the hypothesis that depression in an unselected group of stroke patients is no more common, and of no more specific aetiology, than it is among elderly patients with other physical illness.

Crystal structure of Escherichia coli xanthine phosphoribosyltransferase

Xanthine phosphoribosyltransferase (XPRT; EC 2.4.2.22) from Escherichia coil is a tetrameric enzyme having 152 residues per subunit. XPRT catalyzes the transfer of the phosphoribosyl group from 5-phospho-alpha-D-ribosyl l-pyrophosphate (PRib-PP) to the 6-oxopurine bases guanine, xanthine, and hypoxanthine to form GMP, XMP, and IMP, respectively. Crystals grown in the absence of substrate or product were used to determine the structure of XPRT at a resolution of 1.8 Angstrom by multiple isomorphous replacement. The core structure of XPRT includes a five-stranded parallel B-sheet surrounded by three or-helices, which is similar to that observed in other known phosphoribosyltransferase (PRTase) structures. The XPRT structure also has several interesting features. A glutamine residue in the purine binding site may be responsible for the altered 6-oxopurine base specificity seen in this enzyme compared to other 6-oxopurine PRTases. Also, we observe both a magnesium ion and a sulfate ion bound at the PRib-PP binding site of XPRT. The sulfate ion interacts with Arg-37 which has a cis-peptide conformation, and the magnesium ion interacts with Asp-89, a highly conserved acidic residue in the PRib-PP binding site motif. The XPRT structure also incorporates a feature which has not been observed in other PRTase structures. The C-terminal 12 residues of XPRT adopt an unusual extended conformation and make interactions with a neighboring subunit. The very last residue, Arg-152, could form part of the active site of a symmetry-related subunit in the XPRT tetramer.

The uncharged surface features surrounding the active site of Escherichia coli DsbA are conserved and are implicated in peptide binding

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.

The structure of versutoxin (delta-atracotoxin-Hv1) provides insights into the binding of site 3 neurotoxins to the voltage-gated sodium channel

Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.