The Las Campanas/AAT Rich Cluster Survey - II. The environmental dependence of galaxy colours in clusters at z similar to 0.1

We present a photometric investigation of the variation in galaxy colour with environment in 11 X-ray-luminous clusters at 0.07 less than or equal to z less than or equal to 0.16 taken from the Las Campanas/AAT Rich Cluster Survey. We study the properties of the galaxy populations in individual clusters, and take advantage of the homogeneity of the sample to combine the clusters together to investigate weaker trends in the composite sample. We find that modal colours of galaxies lying on the colour-magnitude relation in the clusters become bluer by d(B - R)/dr(p) = -0.022 +/- 0.004 from the cluster core out to a projected radius of r(p) = 6 Mpc, further out in radius than any previous study. We also examine the variation in modal galaxy colour with local galaxy density, 2, for galaxies lying close to the colour-magnitude relation, and find that the median colour shifts bluewards by d(B - R)/d log(10)(Sigma) = -0.076 +/- 0.009 with decreasing local density across three orders of magnitude. We show that the position of the red envelope of galaxies in the colour-magnitude relation does not vary as a function of projected radius or density within the clusters, suggesting that the change in the modal colour results from an increasing fraction of bluer galaxies within the colour-magnitude relation, rather than a change in the colours of the whole population. We show that this shift in the colour-magnitude relations with projected radius and local density is greater than that expected from the changing morphological mix based on the local morphology-density relation. We therefore conclude that we are seeing a real change in the properties of galaxies on the colour-magnitude relation in the outskirts of clusters. The simplest interpretation of this result (and similar constraints in local clusters) is that an increasing fraction of galaxies in the lower density regions at large radii within clusters exhibit signatures of star formation in the recent past, signatures which are not seen in the evolved galaxies in the highest density regions.

Prediction of promiscuous peptides that bind HLA class I molecules

Promiscuous T-cell epitopes make ideal targets for vaccine development. We report here a computational system, multipred, for the prediction of peptide binding to the HLA-A2 supertype. It combines a novel representation of peptide/MHC interactions with a hidden Markov model as the prediction algorithm. multipred is both sensitive and specific, and demonstrates high accuracy of peptide-binding predictions for HLA-A*0201, *0204, and *0205 alleles, good accuracy for *0206 allele, and marginal accuracy for *0203 allele. multipred replaces earlier requirements for individual prediction models for each HLA allelic variant and simplifies computational aspects of peptide-binding prediction. Preliminary testing indicates that multipred can predict peptide binding to HLA-A2 supertype molecules with high accuracy, including those allelic variants for which no experimental binding data are currently available.

Geospatial clustering in data-rich environments: Features and issues

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

The role of CD4 T help in multiple vaccinations when using minimal CD8 T cell epitope peptides

Background: The fact that some cancers and viral infections can be controlled by effector CD8 T cells led to the possibility of utilising minimal CD8 T cell epitope peptides as vaccines. However using minimal CD8 T cell epitope peptide immunisations and a tumour protection model in mice, we have previously shown that functional memory CD8 T cells are not generated unless CD4 T help is provided at the time of CD8 T cell priming. Short-lived effector cells nevertheless are generated in the absence of T help. Aim: To determine the role of CD4 T help in multiple immunisations. Method: Minimal CD8 T cell peptides of HPV16 E7 protein and Ovalbumin were used (with adjuvants Quil-A or IFA) as immunogens in C57BL mice. The presence of effector CD8 T cells were determined by tumour protection assays and was quantified by IFN-gamma ELISPOT assays. Results: In the present study we show that unless T help is provided at the time CD8 T cells are primed, no CD8 effector cells are generated when boosted with the vaccine again in the absence of T help. Our results further show that this failure could be prevented by the inclusion of a T helper peptide during the primary or booster immunisations.

Could endogenous self-peptides presented by dendritic cells initiate rheumatoid arthritis?

The critical interaction initiating and perhaps perpetuating rheumatoid arthritis (RA) is the presentation of arthritogenic antigen to autoreactive T cells. In contrast to many organ-specific autoimmune diseases, no candidate autoantigens have yet been confirmed for RA. Here, Ranjeny Thomas and Peter Lipsky examine the role of dendritic cells in autoimmune disease, leading to the hypothesis that activation of T cells by endogenous self-peptides may be sufficient to initiate RA.

Antibacterial activity of bovine lactoferrin-derived peptides

Several peptides sharing high sequence homology with lactoferricin B (Lf-cin B) were generated from bovine lactoferrin (Lf) with recombinant chymosin. Two peptides were copurified. one identical to Lf-cin B and another differing from Lf-cin B by the inclusion of a C-terminal alanine (lactoferricin). Two other peptides were copurified from chymosin-hydrolyzed Lf. one differing from Lf-cin B by the inclusion of C-terminal alanyl-leucine and the other being a heterodimer linked by a disulfide bond, These peptides were isolated in a single step from chymosin-hydrolyzed Lf by membrane ton-exchange chromatography and were purified by reverse-phase high-pressure liquid chromatography (HPLC), They were characterized by. N-terminal Edman sequencing, mass spectrometry, and antibacterial activity determination, Pure lactoferricin, prepared from pepsin-hydrolyzed Lf, was purified by standard chromatography techniques, This peptide was analyzed against a number of gram-positive and gram-negative bacteria before and after reduction of its disulfide bond or cleavage after its single methionine residue and was found to inhibit the growth of all the test bacteria at a concentration of 8 mu M or less, Subfragments of lactoferricin were isolated from reduced and cleaved peptide by reverse-phase HPLC, Subfragment 1 (residues I to 10) was active against most of the test microorganisms at concentrations of 10 to 50 mu M. Subfragment 2 (residues 11 to 26) was active against only a few microorganisms at concentrations up to 100 mu M. These antibacterial studies indicate that the activity of lactoferricin Is mainly, but not wholly, due to its N-terminal region.

MHCPEP, a database of MHC-binding peptides: Update 1996

MHCPEP is a curated database comprising over 9000 peptide sequences known to bind MHC molecules. Entries are compiled from published reports as well as from direct submissions of experimental data. Each entry contains the peptide sequence, its MHC specificity and, when available, experimental method, observed activity, binding affinity, source protein, anchor positions and publication references. The present format of the database allows text string matching searches but can easily be converted for use in conjunction with sequence analysis packages. The database can be accessed via Internet using WWW, FTP or Gopher.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Problems associated with spray drying of sugar-rich foods

Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.

Zipping up transcription factors: Rational design of anti-Jun and anti-Fos peptides

Various members of the bZip and bHLH-Zip families of eukaryotic transcription factors, including Jun, Fos, and Myc, have been identified as oncoproteins; mutation or deregulated expression of these proteins leads to certain types of cancer. These proteins can only bind to their cognate DNA enhancer sites following homodimerization, or heterodimerization with another family member, via their leucine zipper domain. Thus, a novel anticancer strategy would be to inhibit dimerization of these proteins, thereby blocking their DNA binding and transactivation functions. In this paper we show that it is possible to rationally design leucine zipper peptides that bind with high affinity to the leucine zipper dimerization domains of c-Jun and c-Fos, thus preventing the formation of functional c-Jun homodimers and c-Jun:c-Fos heterodimers; we refer to such peptides as superzippers (SZs). In vivo, c-Jun:SZ and c-Fos:SZ heterodimers should be nonfunctional as they lack one of the two basic domains that are essential for DNA binding. While the transport of a peptidic agent into cells often poses a severe obstacle to its therapeutic use, we show that a 46-residue leucine zipper peptide can be transported into HeLa cells by coupling it to a 17-residue carrier peptide from the Antennapedia homeodomain, thus paving the way for detailed studies of the therapeutic potential of superzipper peptides.