72 resultados para Lawrenceville Refinery Site (Lawrence County, Ill.)


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The St. Lawrence Island polynya (SLIP) is a commonly occurring winter phenomenon in the Bering Sea, in which dense saline water produced during new ice formation is thought to flow northward through the Bering Strait to help maintain the Arctic Ocean halocline. Winter darkness and inclement weather conditions have made continuous in situ and remote observation of this polynya difficult. However, imagery acquired from the European Space Agency ERS-1 Synthetic Aperture Radar (SAR) has allowed observation of the St. Lawrence Island polynya using both the imagery and derived ice displacement products. With the development of ARCSyM, a high resolution regional model of the Arctic atmosphere/sea ice system, simulation of the SLIP in a climate model is now possible. Intercomparisons between remotely sensed products and simulations can lead to additional insight into the SLIP formation process. Low resolution SAR, SSM/I and AVHRR infrared imagery for the St. Lawrence Island region are compared with the results of a model simulation for the period of 24-27 February 1992. The imagery illustrates a polynya event (polynya opening). With the northerly winds strong and consistent over several days, the coupled model captures the SLIP event with moderate accuracy. However, the introduction of a stability dependent atmosphere-ice drag coefficient, which allows feedbacks between atmospheric stability, open water, and air-ice drag, produces a more accurate simulation of the SLIP in comparison to satellite imagery. Model experiments show that the polynya event is forced primarily by changes in atmospheric circulation followed by persistent favorable conditions: ocean surface currents are found to have a small but positive impact on the simulation which is enhanced when wind forcing is weak or variable.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Absorption kinetics of solutes given with the subcutaneous administration of fluids is ill-defined. The gamma emitter, technitium pertechnetate, enabled estimates of absorption rate to be estimated independently using two approaches. In the first approach, the counts remaining at the site were estimated by imaging above the subcutaneous administration site, whereas in the second approach, the plasma technetium concentration-time profiles were monitored up to 8 hr after technetium administration. Boluses of technetium pertechnetate were given both intravenously and subcutaneously on separate occasions with a multiple dosing regimen using three doses on each occasion. The disposition of technetium after iv administration was best described by biexponential kinetics with a V-ss of 0.30 +/- 0.11 L/kg and a clearance of 30.0 +/- 13.1 ml/min. The subcutaneous absorption kinetics was best described as a single exponential process with a half-life of 18.16 +/- 3.97 min by image analysis and a half-life of 11.58 +/- 2.48 min using plasma technetium time data. The bioavailability of technetium by the subcutaneous route was estimated to be 0.96 +/- 0.12. The absorption half-life showed no consistent change with the duration of the subcutaneous infusion. The amount remaining at the absorption site with time was similar when analyzed using image analysis, and plasma concentrations assuming multiexponential disposition kinetics and a first-order absorption process. Profiles of fraction remaining at the absorption sire generated by deconvolution analysis, image analysis, and assumption of a constant first-order absorption process were similar. Slowing of absorption from the subcutaneous administration site is apparent after the last bolus dose in three of the subjects and can De associated with the stopping of the infusion. In a fourth subject, the retention of technetium at the subcutaneous site is more consistent with accumulation of technetium near the absorption site as a result of systemic recirculation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.

Relevância:

20.00% 20.00%

Publicador: