Characterization of pore wall heterogeneity in nanoporous carbons using adsorption: the slit pore model revisited

In this paper, we propose a new nonlocal density functional theory characterization procedure, the finite wall thickness model, for nanoporous carbons, whereby heterogeneity of pore size and pore walls in the carbon is probed simultaneously. We determine the pore size distributions and pore wall thickness distributions of several commercial activated carbons and coal chars, with good correspondence with X-ray diffraction. It is shown that the conventional infinite wall thickness approach overestimates the pore size slightly. Pore-pore correlation has been shown to have a negligible effect on prediction of pore size and pore wall thickness distributions for small molecules such as argon used in characterization. By utilizing the structural parameters (pore size and pore wall thickness distribution) in the generalized adsorption isotherm (GAI) we are able to predict adsorption uptake of supercritical gases in BPL and Norit RI Extra carbons, in excellent agreement with experimental adsorption uptake data up to 60 MPa. The method offers a useful technique for probing features of the solid skeleton, hitherto studied by crystallographic methods.

Mechanism of ribonuclease inhibition by ribonuclease inhibitor protein based on the crystal structure of its complex with ribonuclease A

We describe the mechanism of ribonuclease inhibition by ribonuclease inhibitor, a protein built of leucine-rich repeats, based on the crystal structure of the complex between the inhibitor and ribonuclease A. The structure was determined by molecular replacement and refined to an R(cryst) of 19.4% at 2.5 Angstrom resolution. Ribonuclease A binds to the concave region of the inhibitor protein comprising its parallel beta-sheet and loops. The inhibitor covers the ribonuclease active site and directly contacts several active-site residues. The inhibitor only partially mimics the RNase-nucleotide interaction and does not utilize the pi phosphate-binding pocket of ribonuclease A, where a sulfate ion remains bound. The 2550 Angstrom(2) of accessible surface area buried upon complex formation may be one of the major contributors to the extremely tight association (K-i = 5.9 x 10(-14) M). The interaction is predominantly electrostatic; there is a high chemical complementarity with 18 putative hydrogen bonds and salt links, but the shape complementarity is lower than in most other protein-protein complexes. Ribonuclease inhibitor changes its conformation upon complex formation; the conformational change is unusual in that it is a plastic reorganization of the entire structure without any obvious hinge and reflects the conformational flexibility of the structure of the inhibitor. There is a good agreement between the crystal structure and other biochemical studies of the interaction. The structure suggests that the conformational flexibility of RI and an unusually large contact area that compensates for a lower degree of complementarity may be the principal reasons for the ability of RI to potently inhibit diverse ribonucleases. However, the inhibition is lost with amphibian ribonucleases that have substituted most residues corresponding to inhibitor-binding residues in RNase A, and with bovine seminal ribonuclease that prevents inhibitor binding by forming a dimer. (C) 1996 Academic Press Limited

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Pirellulosomes: A new type of membrane-bounded cell compartment in planctomycete bacteria of the genus Pirellula

A distinct type of cellular organization was found in two species of the planctomycete genus Pirellula, Pirellula marina and Pirellula staleyi. Both species possess two distinct regions within the cell which are separated by a single membrane. The major region of the cell, the pirellulosome, contains the fibrillar condensed nucleoid. The other area, the polar cap region, forms a continuous layer surrounding the entire pirellulosome and displays a cap of asymmetrically distributed material at one cell pole. Immuno- and cytochemical-labelling of P. marina demonstrated that DNA is located exclusively within the pirellulosome; cell RNA is concentrated in the pirellulosome, with some RNA also located in the polar cap region.

Numerical and experimental study of a homogenizer impinging jet

High-pressure homogenization is a key unit operation used to disrupt cells containing intracellular bioproducts. Modeling and optimization of this unit are restrained by a lack of information on the flow conditions within a homogenizer value. A numerical investigation of the impinging radial jet within a homogenizer value is presented. Results for a laminar and turbulent (k-epsilon turbulent model) jet are obtained using the PHOENICS finite-volume code. Experimental measurement of the stagnation region width and correlation of the cell disruption efficiency with jet stagnation pressure both indicate that the impinging jet in the homogenizer system examined is likely to be laminar under normal operating conditions. Correlation of disruption data with laminar stagnation pressure provides a better description of experimental variability than existing correlations using total pressure drop or the grouping 1/Y(2)h(2).

Two estimates concerning asymptotics of the minimizations of a Ginzburg-Landau functional

We prove two asymptotical estimates for minimizers of a Ginzburg-Landau functional of the form integral(Omega) [1/2 \del u\(2) + 1/4 epsilon(2) (1 - \u\(2))(2) W (x)] dx.

Nitric oxide and tissue destruction

Nitric oxide (NO) is a free radical which has complex roles in both health and disease. It is now recognized that NO is essential for a vast spectrum of intracellular and extracellular events in a wide variety of tissues. NO has also been implicated in the pathogenesis of numerous inflammatory and autoimmune diseases. In this review we consider the roles of NO generally and in particular the implications for periodontal diseases.

Structural and morphological anomalies in magnetosomes: possible biogenic origin for magnetite in ALH84001

We report biogenic magnetite whiskers, with axial ratios of 6: 1, elongated in the [1 1 1]. [1 1 2] and [1 0 0] directions, resembling the magnetite whiskers detected in the Martian meteorite ALH84001 by Bradley ct nl., and interpreted by those authors as evidence of vapour-phase (abiogenic) growth. Magnetosomal whiskers with extended defects consistent with screw dislocations and magnetosomes resembling flattened twinned platelets, as well as other twinning phenomena and other structural defects, are also reported here. Magnetosomes with teardrop-shaped. cuboidal. irregular and jagged structures similar to those detected in ALH84001 by McKay et al.. coprecipitation of magnetite possibly with amorphous calcium carbonate, coprecipitation of magnetite possibly with amorphous silica, the incorporation of titanium in volutin inclusions and disoriented arrays of magnetosomes are also described. These observations demonstrate that the structures of the magnetite particles in ALH84001. their spatial arrange ment and coprecipitation with carbonates and proximity to silicates are consistent with being biogenic. Electron-beam-induced flash-melting of magnetosomes produced numerous screw dislocations in the (1 1 1). (1 0 0) and (1 1 0) lattice planes and induced fusion of platelets. From this, the lack of screw dislocations reported in the magnetite particles in ALH84001 (McKay et al.. and Bradley et al.) indicates that they have a low-temperature origin.

The effects of copper on the microbial community of a coral reef sponge

Marine sponges often harbour communities of symbiotic microorganisms that fulfil necessary functions for the well-being of their hosts. Microbial communities associated with the sponge Rhopaloeides odorabile were used as bioindicators far sublethal cupric ion (Cu2+) stress. A combined strategy incorporating molecular, cultivation and electron microscopy techniques was adopted to monitor changes in microbial diversity. The total density of sponge-associated bacteria and counts of the predominant cultivated symbiont (alpha -proteobacterium strain NW001) were significantly reduced in response to Cu2+ concentrations of 1.7 mug l(-1) and above after 14 days of exposure. The number of operational taxonomic units (OTUs) detected by restriction fragment length polymorphism (RFLP) decreased by 64% in sponges exposed to 223 mug l(-1) Cu2+ for 48 h and by 46% in sponges exposed to 19.4 mug l(-1) Cu2+ for 14 days. Electron microscopy was used to identify 17 predominant bacterial morphotypes, composing 47% of the total observed cells in control sponges. A reduction In the proportion of these morphotypes to 25% of observed cells was evident in sponges exposed to a Cu2+ concentration of 19.4 mug l(-1). Although the abundance of most morphotypes decreased under Cu2+ stress, three morphotypes were not reduced in numbers and a single morphotype actually increased in abundance. Bacterial numbers, as detected using fluorescence in situ hybridization (FISH), decreased significantly after 48 h exposure to 19.4 mug l(-1) Cu2+. Archaea, which are normally prolific in R. odorabile, were not detected after exposure to a Cu2+ concentration of 19.4 mug l(-1) for 14 days, indicating that many of the microorganisms associated with R. odorabile are sensitive to free copper. Sponges exposed to a Cu2+ concentration of 223 mug l(-1) became highly necrosed after 48 h and accumulated 142 +/- 18 mg kg(-1) copper, whereas sponges exposed to 19.4 mug l(-1) Cu2+ accumulated 306 +/- 15 mg kg(-1) copper after 14 days without apoptosis or mortality. Not only do sponges have potential for monitoring elevated concentrations of heavy metals but also examining changes in their microbial symbionts is a novel and sensitive bioindicator for the assessment of pollution on important microbial communities.

Phylogeny of the filamentous bacterium 'Nostocoida limicola' III from activated sludge

Five strains of the filamentous bacterium 'Nostocoida limicola' III were successfully isolated into pure culture from samples of activated sludge biomass from five plants in Australia. 16S rRNA gene sequence analyses showed that all isolates were members of the Planctomycetales, most closely related to Isosphaera pallida, but they differed phenotypically from this species in that they did not glide and were not thermotolerant. The ultrastructure of these 'N. limicola' III isolates was also consistent with them being Planctomycetales, in that they possessed complex intracellular membrane systems compartmentalizing the cells. However, the arrangements of these intracellular membranes differed between isolates. These data confirm that 'N. limicola' III is phylogenetically unrelated to both 'N. limicola' I and 'N. limicola' II, activated sludge filamentous bacteria which share morphological features in common with 'N. limicola' III and which have been presumed historically to be the same or very similar bacteria.

Dengue virus binding to human leukocyte cell lines: receptor usage differs between cell types and virus strains

Monocyte macrophages (M phi) are thought to be the principal target cells for the dengue viruses (DV), the cause of dengue fever and hemorrhagic fever. Cell attachment is mediated by the virus envelope (E) protein, but the host-cell receptors remain elusive. Currently, candidate receptor molecules include proteins, Fc receptors, glycosaminoglycans (GAGs) and lipopolysaccharide binding CD14-associated molecules. Here, we show that in addition to M phi, cells of the T- and B-cell lineages, and including cells lacking GAGs, can bind and become infected with DV. The level of virus binding varied widely between cell lines and, notably, between virus strains within a DV serotype. The latter difference may be ascribable to one or more amino acid differences in domain II of the E protein. Heparin had no significant effect on DV binding, while heparinase treatment of cells in all cases increased DV binding, further supporting the contention that GAGs are not required for DV binding and infection of human cells. In contrast to a recent report, we found that lipopolysaccharide (LPS) had either no effect or enhanced DV binding to, and infection of various human leukocyte cell lines, while in all virus-cell combinations, depletion of Ca2+/Mg2+ enhanced DV binding. This argues against involvement of beta (2) integrins in virus-host cell interactions, a conclusion in accord with the demonstration of three virus binding membrane proteins of < 75 kDa. Collectively, the results of this study question the purported exclusive importance of the E protein domain III in DV binding to host cells and point to a far more complex interaction between various target cells and, notably, individual DV strains. (C) 2001 Elsevier Science B.V. All rights reserved.

The geochemistry of late Archaean microbial carbonate: Implications for ocean chemistry and continental erosion history

Trace element concentrations and combined Sr- and Nd-isotope compositions were determined on stromatolitic carbonates (microbialites) from the 2.52 Ga Campbellrand carbonate platform (South Africa). Shale-normalised rare earth element and yttrium patterns of the ancient samples are similar to those of modern seawater in having positive La and Y anomalies and in being depleted in light rare earth elements. In contrast to modem seawater (and microbialite proxies), the 2.52 Ga samples lack a negative Ce anomaly but possess a positive Eu anomaly. These latter trace element characteristics are interpreted to reflect anoxic deep ocean waters where, unlike today, hydrothermal Fe input was not oxidised, and scavenged and rare earth elements were not coprecipitated with Fe-oxyhydroxides. The persistence of a positive Eu anomaly in relatively shallow Campbellrand platform waters indicates a dramatic reversal from hydrothermally dominated (Archaean) to continental erosion-dominated (Phanerozoic) rare earth element flux ratio. The dominant hydrothermal input is also expressed in the initial Sr- and Nd-isotope ratios. There is collinear variation in Sr-Nd systematics, which range from primitive values (Sr-87/Sr-86 of 0.702386 and epsilon (Nd) of +2.1) to more evolved crustal ratios. Mixing calculations show that the range in trace element ratios (e.g., Y/Ho) and initial isotope ratios is not a result of contamination by trapped sediment, but that the chemical band isotopic variation reflects carbonate deposition in an environment where different water masses mixed. Calculated Nd flux ratios yield a hydrothermal input into the 2.52 Ga oceans one order of magnitude larger than continental input. Such a change in flux ratio most likely required substantially reduced continental inputs, which could, in turn, reflect a plate tectonic causation (e.g., reduced topography or expansion of epicontinental seas). Copyright (C) 2001 Elsevier Science Ltd.

Stimulation of protein kinase C-dependent and -independent signaling pathways by bistratene A in intestinal epithelial cells

The marine toxin bistratene A (BisA) potently induces cytostasis and differentiation in a variety of systems. Evidence that BisA is a selective activator of protein kinase C (PKC) delta implicates PKC delta signaling in the negative growth-regulatory effects of this agent. The current study further investigates the signaling pathways activated by BisA by comparing its effects with those of the PKC agonist phorbol 12-myristate 13-acetate (PMA) in the IEC-18 intestinal crypt cell line. Both BisA and PMA induced cell cycle arrest in these cells, albeit with different kinetics. While BisA produced sustained cell cycle arrest in G(o)/G(1) and G(2)/M, the effects of PMA were transient and involved mainly a G(o)/G(1), blockade. BisA also produced apoptosis in a proportion of the population, an effect not seen with PMA. Both agents induced membrane translocation/activation of PKC, with BisA translocating only PKC delta and PMA translocating PKC alpha, delta, and epsilon in these cells. Notably, while depletion of PKC alpha, delta, and epsilon abrogated the cell cycle-specific effects of PMA in IEC-18 cells, the absence of these PKC isozymes failed to inhibit BisA-induced G(o)/G(1), and G(2)/M arrest or apoptosis. The cell cycle inhibitory and apoptotic effects of BisA, therefore, appear to be PKC-independent in IEG-18 cells. On the other hand, BisA and PMA both promoted PKC-dependent activation of Erk 1 and 2 in this system. Thus, intestinal epithelial cells respond to BisA through activation of at least two signaling pathways: a PKC delta -dependent pathway, which leads to activation of mitogen-activated protein kinase and possibly cytostasis in the appropriate context, and a PKC-independent pathway, which induces both cell cycle arrest in G(o)/G(1) and G(2)/M and apoptosis through as yet unknown mechanisms. (C) 2001 Elsevier Science Inc. All rights reserved.

The entrapment of particles by windbreaks

A theory is developed for calculating the entrapment of particles by a windbreak, with four results. (1) The fraction of particles in the oncoming flow which pass through the windbreak, or transmittance of the windbreak for particles (sigma), is related to the optical porosity (tau). The very simple approximation sigma=tau works well for most applications involving the interception of spray droplets by windbreaks. Results from a field experiment agree with the theoretical predictions. (2) A new equation for the bulk drag coefficient of a windbreak is tested against numerical, wind tunnel and field experiments. This enables the bleed velocity for the flow through the windbreak to be predicted in terms of the screen pressure coefficient (k) of the barrier. (3) The relationship between k and tau is different for a vegetative barrier than for a screen across a confined duct, implying a lower Fc for given tau. (4) The total deposition of particles to a windbreak is determined by a trade-off between particle absorption and throughflow, implying an optimum value of tau for maximum total deposition. For particles larger than 30 mum and vegetation elements smaller than 30 mm, this occurs near tau = 0.2. (C) 2001 Elsevier Science Ltd. All rights reserved.

A caveolin dominant negative mutant associates with lipid bodies and induces intracellular cholesterol imbalance

Recent studies have indicated a role for caveolin in regulating cholesterol-dependent signaling events. In the present study we have analyzed the role of caveolins in intracellular cholesterol cycling using a dominant negative caveolin mutant. The mutant caveolin protein, cav-3(DGV) specifically associates with the membrane surrounding large lipid droplets. These structures contain neutral lipids, and are accessed by caveolin 1-3 upon overexpression. Fluorescence, electron, and video microscopy observations are consistent with formation of the membrane-enclosed lipid rich structures by maturation of subdomains of the ER. The caveolin mutant causes the intracellular accumulation of free cholesterol (FC) in late endosomes, a decrease in surface cholesterol and a decrease in cholesterol efflux and synthesis. The amphiphile U18666A acts synergistically with cav(DGV) to increase intracellular accumulation of FC. Incubation of cells with oleic acid induces a significant accumulation of full-length caveolins in the enlarged lipid droplets. We conclude that caveolin can associate with the membrane surrounding lipid droplets and is a key component involved in intracellular cholesterol balance and lipid transport in fibroblasts.