A comparison of the performance and biological efficiency of new knapsack sprayers and a controlled droplet application (CDA) sprayer for the control of the diamondback moth, Plutella xylostella L. (Lepidoptera : Plutellidae)

Field trials and laboratory bioassays were undertaken to compare the performance and efficacy (mortality of diamondback moth larvae) of insecticides applied to cabbages with three high volume hydraulic knapsack sprayers (NS-16, PB-20 and Selecta 12V) and a controlled droplet application (CDA) sprayer. In field experiments, the high volume knapsack sprayers (application rate 500-600 L ha(-1)) provided better spray coverage on the upper and lower surfaces of inner leaves, the upper surfaces of middle and outer leaves, and greater biological efficacy than the CDA sprayer (application rate 20similar to40 L ha(-1)). The PB-20 provided better spray coverage on the upper surface of middle leaves and both surfaces of outer leaves when compared with the Selecta 12V. However, its biological efficacy in the field was not significantly different from that of the other high volume sprayers. Increasing the application rate from 20 to 40 L ha(-1) for the CDA sprayer significantly increased droplet density but had no impact on test insect mortality. Laboratory evaluations of biological efficacy yielded higher estimates than field evaluations and there was no significant difference between the performance of the PB-20 and the CDA sprayer. Significant positive relationships were detected between insect mortality and droplet density deposited for both the PB-20 and the CDA sprayers.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Homocysteine-lowering treatment with folic acid, cobalamin, and pyridoxine does not reduce blood markers of inflammation, endothelial dysfunction, or hypercoagulability in patients with previous transient ischemic attack or stroke - a randomized substudy

Background and Purpose - Epidemiological and laboratory studies suggest that increasing concentrations of plasma homocysteine ( total homocysteine [tHcy]) accelerate cardiovascular disease by promoting vascular inflammation, endothelial dysfunction, and hypercoagulability. Methods - We conducted a randomized controlled trial in 285 patients with recent transient ischemic attack or stroke to examine the effect of lowering tHcy with folic acid 2 mg, vitamin B-12 0.5 mg, and vitamin B-6 25 mg compared with placebo on laboratory markers of vascular inflammation, endothelial dysfunction, and hypercoagulability. Results - At 6 months after randomization, there was no significant difference in blood concentrations of markers of vascular inflammation (high-sensitivity C-reactive protein [P = 0.32]; soluble CD40L [ P = 0.33]; IL-6 [P = 0.77]), endothelial dysfunction ( vascular cell adhesion molecule-1 [P = 0.27]; intercellular adhesion molecule-1 [P = 0.08]; von Willebrand factor [P = 0.92]), and hypercoagulability (P-selectin [P = 0.33]; prothrombin fragment 1 and 2 [P = 0.81]; D-dimer [P = 0.88]) among patients assigned vitamin therapy compared with placebo despite a 3.7-mumol/L (95% CI, 2.7 to 4.7) reduction in total homocysteine (tHcy). Conclusions - Lowering tHcy by 3.7 mumol/L with folic acid-based multivitamin therapy does not significantly reduce blood concentrations of the biomarkers of inflammation, endothelial dysfunction, or hypercoagulability measured in our study. The possible explanations for our findings are: ( 1) these biomarkers are not sensitive to the effects of lowering tHcy (eg, multiple risk factor interventions may be required); ( 2) elevated tHcy causes cardiovascular disease by mechanisms other than the biomarkers measured; or ( 3) elevated tHcy is a noncausal marker of increased vascular risk.

Translational incorporation of L-3,4-dihydroxyphenylalanine into proteins

An Escherichia coli cell-free transcription/translation system was used to explore the high-level incorporation Of L-3,4-dihydroxyphenylalanine (DOPA) into proteins by replacing tyrosine with DOPA in the reaction mixtures. ESI-MS showed specific incorporation of DOPA in place of tyrosine. More than 90% DOPA incorporation at each tyrosine site was achieved, allowing the recording of clean N-15-HSQC NMR spectra. A redox-staining method specific for DOPA was shown to provide a sensitive and generally applicable method for assessing the cell-free production of proteins. Of four proteins produced in soluble form in the presence of tyrosine, two resulted in insoluble aggregates in the presence of high levels of DOPA. DOPA has been found in human proteins, often in association with various disease states that implicate protein aggregation and/or misfolding. Our results suggest that misfolded and aggregated proteins may result, in principle, from ribosome-mediated misincorporation of intracellular DOPA accumulated due to oxidative stress. High-yield cell-free protein expression systems are uniquely suited to obtain rapid information on solubility and aggregation of nascent polypeptide chains.

Seed dormancy and germination responses of nine Australian fire ephemerals

Fire ephemerals are short-lived plants with seeds that persist in the soil and germinate after a fire or physical soil disturbance. Ex situ germination of many Australian fire ephemerals has previously been difficult. Dormancy was present in most of the nine fire ephemerals examined. Alyogyne hakeifolia (Giord.) Alef. and Alyogyne huegelii (Endl.) Fryxell (Malvaceae) seeds had physical and possibly also physiological dormancy, Actinotus leucocephalus Benth. (Apiaceae) seeds had morphophysiological dormancy, Austrostipa compressa (R.Br.) S.W.L. Jacobs & J. Everett and Austrostipa macalpinei (Reader) S.W.L. Jacobs & J. Everett (Poaceae) seeds were either non-dormant or possessed physiological dormancy, and seeds of all remaining species possessed physiological dormancy. A proportion of the Alyogyne hakeifolia, Alyogyne huegelii, Austrostipa compressa and Austrostipa macalpinei seed populations were non-dormant because some seeds could germinate at the various incubation temperatures without further treatment. At 20 degrees C, artificial methods of inducing germination such as manual or acid scarification were among the optimal treatments for Austrostipa compressa, Austrostipa macalpinei, Alyogyne huegelii, Actinotus leucocephalus and Grevillea scapigera A.S. George (Proteaceae), and gibberellic acid induced maximum germination of Tersonia cyathiflora (Fenzl) J.W. Green (Gyrostemonaceae) seeds. Heat (70 degrees C for 1 h) and smoke water was one of the most effective treatments for germinating Actinotus leucocephalus and Codonocarpus cotinifolius (Desf.) F. Muell. (Gyrostemonaceae) seeds. Germination of Grevillea scapigera, Codonocarpus cotinifolius, Gyrostemon racemiger H. Walter (Gyrostemonaceae) and Tersonia cyathiflora did not exceed 40% and may require other treatments to overcome dormancy. Although the nine fire ephemerals examined require fire to germinate under natural conditions, a range of germination responses and dormancy types was observed.

Re-dating mid-Holocene betelnut (Areca catechu L.) and other plant use at Dongan, Papua New Guinea

Direct accelerator mass spectrometry (AMS) dating of anaerobically preserved plant remains from the Dongan site in New Guinea, combined with assessment of preservation condition, confirms earlier doubts about the antiquity of betel-nut (Areca catechu L.) found at the site. A possible sago leaf fragment is also identified as a modem contaminant. The mid-Holocene age of other fruit and nut remains is verified using these methods. The utility of AMS dating in combination with detailed archaeobotanical assessment is demonstrated, thus improving chronometric hygiene and with it knowledge of past plant use in Oceania.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Occurrence of cutaneous infections of Myxobolus episquamalis (Myxozoa: Myxobolidae) in sea mullet, Mugil cephalus L, in Australia

Objective To report the occurrence of Myxobolus episquamalis in sea mullet, Mugil cephalus L, caught in estuaries in eastern and western Australia. Design A prospective study of commercial catches of mullet in the Clarence River of NSW and individual cases from other areas. Results The organism caused pale, white to pink, raised lesions on the scales and fins of sea mullet. Occurrence of infection was highest in spring and in a marine (down-river) environment compared to a brackish environment. Up to 6% of fish were affected in commercial catches. Conclusion The infection is widespread in Australian mullet, but rarely causes significant economic loss.

Rapid increases in cytokinin concentration in lateral buds of chickpea (Cicer arietinum L) during release of apical dominance

We examined the role of cytokinins (CKs) in release of apical dominance in lateral buds of chickpea (Cicer arietinum L.). Shoot decapitation or application of CKs (benzyladenine, zeatin or dihydrozeatin) stimulated rapid bud growth. Time-lapse video recording revealed growth initiation within 2 h of application of 200 pmol benzyladenine or within 3 h of decapitation. Endogenous CK content in buds changed little in the first 2 h after shoot decapitation, but significantly increased by 6 h, somewhat later than the initiation of bud growth. The main elevated CK was zeatin riboside, whose content per bud increased 7-fold by 6 h and 25-fold by 24 h. Lesser changes were found in amounts of zeatin and isopentenyl adenine CKs. We have yet to distinguish whether these CKs are imported from the roots via the xylem stream or are synthesised in situ in the buds, but CKs may be part of an endogenous signal involved in lateral bud growth stimulation following shoot decapitation. To our knowledge, this is the first detailed report of CK levels in buds themselves during release of apical dominance.

The pattern and control of reproductive development in non-astringent persimmon (Diospyros kaki L.): a review

Non-astringent persimmon is rapidly expanding as a new fruit crop in warm subtropical regions of the world, Most research and development of this fruit crop has occurred in Japan, where there is a considerable amount of published literature on its performance. Much of this information is not readily accessible to other countries and needs to be interpreted and modified for other climatic regions. This paper reviews reproductive events from floral initiation to the completion of fruit growth. The timing and significance of these events is described in relation to the phenological cycle. Method of improving flowering, reducing fruit drop and altering the fruit maturity period are discussed. (C) 1997 Elsevier Science B.V.