52 resultados para Andral, Gr


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Generalized epilepsy with febrile seizures plus (GEFS(+)) is an important childhood genetic epilepsy syndrome with heterogeneous phenotypes, including febrile seizures (FS) and generalized epilepsies of variable severity. Forty unrelated GEFS(+) and FS patients were screened for mutations in the sodium channel beta-subunits SCN1B and SCN2B, and the second GEFS(+) family with an SCN1B mutation is described here. The family had 19 affected individuals: 16 with typical GEFS(+) phenotypes and three with other epilepsy phenotypes. Site-specific mutation within SCN1B remains a rare cause of GEFS(+), and the authors found no evidence to implicate SCN2B in this syndrome.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The intercalated discs of working myocardium and Purkinje fibers of the monkey heart were examined by scanning and transmission electron microscopy. The NaOH/ultrasonication technique resulted in the digestion of connective tissue and a separation of the intercellular junctions of intercalated discs, such that these could be visualized three-dimensionally. The intercalated discs of ventricular myocytes, atrial myocytes and Purkinje fibers vary considerably in number and configuration, as do the intercalated discs of the three different layers of the ventricular myocardium. Myocytes in the subepicardial, middle and subendocardial layers of the ventricle have 1-3, 4-5 and 5-6 intercalated discs at the end of these cells, respectively, Those in the endocardial layer are characterized by the presence of small laterally-placed intercalated discs. Atrial myocytes and Purkinje fibers usually only have 1-2 intercalated discs, Individual intercalated discs in ventricular myocytes have complicated stairs with 10-30 steps and corresponding risers, while those of atrial myocytes and Purkinje fibers have simple stairs with 1-3 steps and risers, Steps equivalent to the plicate segments are characterized by densely-packed microplicae and finger-like microprojections which greatly increase surface area in vertricular myocytes, Microprojections in atrial myocytes and Purkinje fibers are sparse by comparison, Risers equivalent to the interplicate segments containing large gap junctional areas are most numerous in left ventricular myocytes, followed by right ventricular myocytes, Purkinje fibers and atrial myocytes in decreasing order. The geometric arrangement of the various types of myocytes may be related with impulse propagation. Large intercalated discs of cell trunks and series branches may participate in longitudinal propagation, while small laterally-placed ones may be the site of transverse propagation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The value of a seasonal forecasting system based on phases of the Southern Oscillation was estimated for a representative dryland wheat grower in the vicinity of Goondiwindi. In particular the effects on this estimate of risk attitude and planting conditions were examined. A recursive stochastic programming approach was used to identify the grower's utility-maximising action set in the event of each of the climate patterns over the period 1894-1991 recurring In the imminent season. The approach was repeated with and without use of the forecasts. The choices examined were, at planting, nitrogen application rate and cultivar and, later in the season, choices of proceeding with or abandoning each wheat activity, The value of the forecasting system was estimated as the maximum amount the grower could afford to pay for its use without expected utility being lowered relative to its non use.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We have observed previously that Ca2+ pump-mediated Ca2+ efflux is elevated in cultured aortic smooth muscle cells from spontaneously hypertensive rats compared to those from Wistar-Kyoto rat controls. The objective of this work was to determine if these strains differ in mRNA levels for the PMCA1 isoform of the plasma membrane Ca2+-ATPase and the SERCA2 isoform of the sarcoplasmic reticulum Ca2+-ATPase. mRNA levels were compared in cultured aortic smooth muscle cells from 10-week-old male rats. PMCA1 and SERCA2 mRNA levels were elevated in SHR compared to WKY. Angiotensin II increased the level of PMCA1 and SERCA2 mRNA in both strains. These studies provide further evidence for alterered Ca2+ homeostasis in hypertension at the level of Ca2+ transporting ATPases in the spontaneously hypertensive rat model. These data are also consistent with the hypothesis that the expression of these two Ca2+ pumps may be linked. (C) 1997 Academic Press

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Numerous studies investigating the possible role of altered Ca2+ homeostasis in hypertension have compared resting and agonist-stimulated intracellular free Ca2+ ([Ca2+](i)) in cultured aortic smooth muscle cells from spontaneously hypertensive (SHR) and normotensive Wistar-Kyoto (WKY) rats. However, such studies have not given consistent results. Differences in the method used to load cells with the Ca2+-sensitive indicator fura-2 have been investigated here as a possible source of variability between studies. We also describe the adaptation of a fluorescence technique for the assessment of basal Ca2+ permeability in SHR and WKY through the measurement of Mn2+ influx. The results are consistent with the hypothesis that basal Ca2+ influx is elevated in cultured aortic smooth muscle cells from SHR compared to those from WKY. However, this was not reflected as a significant difference between the two strains in basal or angiotensin II (200 nmol/L)stimulated [Ca2+](i). Furthermore, this result was not dependent on the protocol used to load cells with fura-2. Hence, measurement of bulk [Ca2+](i) does not appear to be the most sensitive parameter for altered Ca2+ homeostasis in SHR. Other compartments of the cell may better reflect altered Ca2+ fluxes in hypertension and are discussed in this work.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Propylthiouracil (PTU) is widely believed to cross the placenta less freely than methimazole (MMI) and is therefore regarded as the preferred drug for treatment of hyperthyroidism in pregnancy. Clinical studies comparing the two drugs show, however, no differences in maternal or fetal thyroid function. We investigated transfer from the maternal to the fetal circuit in the isolated perfused term human placental lobule of low and high doses of PTU (4 mu g/mL and 40 mu g/mL) and MMI(1.5 mu g/mL and 15 mu g/mL) in protein-free perfusate and low doses of both drugs with addition of 40 g/L of bovine albumin. Both drugs readily crossed the placenta, reaching equilibrium in all experiments in about 2 h. Drug concentrations in the two circuits fitted a two compartmental model. Transfer kinetics for the two drugs were similar, nonsaturable, and unaffected by addition of albumin. Clearances (mL.min(-1).g(-1), means +/- SD) of PTU from maternal to fetal circuits were: 0.229 +/- 0.110, 0.216 +/- 0.065, and 0.170 +/- 0.032; and for transfer of MMI: 0.165 +/- 0.025, 0.232 +/- 0.153, and 0.174 +/- 0.009 (for low doses without, low doses with, and high doses without albumin, respectively). Clearances of PTU from fetal to maternal circuits were: 0.147 +/- 0.072, 0.109 +/- 0.014, and 0.116 +/- 0.028; and for transfer of MMI: 0.095 +/- 0.029, 0.122 +/- 0.088, and 0.12 +/- 0.005 (in the same experiments). There was no significant difference between drugs or drug doses and no effect of addition of albumin. We conclude that PTU and MMI have similar placental transfer kinetics.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Protein, amino acids and ammonium were the main forms of soluble soil nitrogen in the soil solution of a subtropical heathland (wallum). After fire, soil ammonium and nitrate increased 90- and 60-fold, respectively. Despite this increase in nitrate availability after fire, wallum species exhibited uniformly low nitrate reductase activities and low leaf and xylem nitrate, During waterlogging soil amino acids increased, particularly gamma-aminobutyric acid (GABA) which accounted for over 50% of amino nitrogen. Non-mycorrhizal wallum species were significantly (P < 0.05) N-15-enriched (0.3-4.3 parts per thousand) compared to species with mycorrhizal associations (ericoid-type, ecto-, va-mycorrhizal) which were strongly depleted in N-15 (-6.3 to -1.8 parts per thousand). Lignotubers and roots had delta(15)N signatures similar to that of the leaves of respective species. The exceptions were fine roots of ecto-, ecto/va-, and ericoid type mycorrhizal species which were enriched in N-15 (0.1-2 4 parts per thousand). The delta(15)N signatures of delta(15)N(total soil N) and delta(15)N(soil NH4+) were in the range 3.7-4.5 parts per thousand, whereas delta(15)N(soil NO3-) was significantly (P < 0.05) more enriched in N-15 (9.2-9.8 parts per thousand). It is proposed that there is discrimination against N-15 during transfer of nitrogen from fungal to plant partner. Roots of selected species incorporated nitrogen sources in the order of preference: ammonium > glycine > nitrate. The exception were proteoid roots of Hakea (Proteaceae) which incorporated equal amounts of glycine and ammonium.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this study, we have compared the effector functions and fate of a number of human CTL clones in vitro or ex vivo following contact with variant peptides presented either on the cell surface or in a soluble multimeric format. In the presence of CD8 coreceptor binding, there is a good correlation between TCR signaling, killing of the targets, and Fast-mediated CTL apoptosis. Blocking CD8 binding using (alpha3 domain mutants of MHC class I results in much reduced signaling and reduced killing of the targets. Surprisingly, however, Fast expression is induced to a similar degree on these CTLs, and apoptosis of CTL is unaffected. The ability to divorce these events may allow the deletion of antigen-specific and pathological CTL populations without the deleterious effects induced by full CTL activation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The hepatotoxin cylindrospermopsin (CYN) has been isolated from the cyanobacterium Cylindrospermopsis raciborskii (C. raci.). Efforts to study this toxin have been hampered by the time-consuming requirement to extract it from cultures of the organism. It is usually extracted from lyophilized cells collected from a laboratory culture. Our preliminary work suggested far more of the toxin is available in solution in the culture media than in the cells collected. We have therefore investigated the use of commercially available solid phase extraction sorbents to extract CYN from culture media in which C. raci. has been grown. A range of reverse phase and ion-exchange sorbents were tested across a range of pHs for their ability to retain CYN without success. Subsequently, graphitized carbon cartridges were found to retain CYN strongly. Elution with 5% formic acid in methanol allowed the CYN to be regained for final purification by HPLC. Deoxy-CYN, an analog of CYN can also be extracted using this procedure. (C) 2001 John Wiley & Sons, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Radiolabelled C-14 cylindrospermopsin (CYN) has been prepared and used to investigate the distribution and excretion of CYN in vivo in male Quackenbush mice. At a dose of 0.2 mg/kg (i.e., approx. median lethal dose) the following mean (SID) urinary and faecal recoveries (cumulative) were obtained, respectively: (0-6 hours, n = 4) 48.2 (29.3)%, 11.9 (21.4)%; (0-12 hours, n = 12) 66.0 (27.1)%, 5.7 (5.6)%; (0-24 hours, n = 12) 68.4 (26.7)%, 8.5 (8.1)%. Mean (SD) recoveries from livers at 6 hours were 20.6 (6.4)% (n = 4), at 48 hours 13.1 (7.7)% (n = 8), and 5-7 days were 2.1 (2.1)% (n = 8). A substantial amount (up to 23%) can be retained in the liver for up to 48 hours with a lesser amount retained in the kidneys. The excretion patterns show substantial interindividual variability between predominantly faecal or urinary excretion, but these patterns are not related in any simple manner to the outcome in terms of toxicity. There is at least one methanol-extractable metabolite as well as a nonmethanol-extractable metabolite in the liver. The methanol-extractable metabolite was not found in the kidney and is more hydrophilic than CYN itself on reverse phase. (C) 2001 by John Wiley & Sons, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Peroxisome proliferator-activated receptor-alpha (PPAR alpha) is a member of the steroid hormone receptor superfamily. In rodents, PPAR alpha. alters genes involved in cell cycle regulation in hepatocytes. Some of these genes are implicated in neuronal cell death. Therefore, in this study, we examined the toxicological consequence of PPAR alpha activation in rat primary cultures of cerebellar granule neurons. Our studies demonstrated the presence of PPAR alpha mRNA in cultures by reverse transcriptase-polymerase chain reaction. After 10 days in vitro, cerebellar granule neuron cultures were incubated with the selective PPAR alpha activator 4-chloro-6-(2,3-xylidino)2-pyrimidinylthioacetic acid (Wy-14,643). The inherent toxicity of Wy-14,643 and the effect of PPAR alpha activation following toxic stimuli were assessed. In these studies, neurotoxicity was induced through reduction of extracellular [KCl] from 25 mM to 5.36 mM. We observed no inherent toxicity of Wy-1 4,643 (24 hr) in cultured cerebellar granule cells. However, after reduction of [KCl], cerebellar granule cell cultures incubated with Wy-14,643 showed significantly greater toxicity than controls. These results suggest a posssible role for PPAR(x in augmentation of cerebellar granule neuronal death after toxic stimuli. (C) 2001 Wiley-Liss, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The use of DNA adduct measurement as a biomarker of exposure to polycyclic aromatic hydrocarbons (PAHs) is now well established in ecotoxicology. In particular, DNA adduct levels in aquatic organisms has been found to produce a better correlation with PAH exposure than PAH concentrations in organisms. DNA adducts levels are most commonly determined using the P-32-postlabelling assay which measures total aromatic adducts. The relationship between relative DNA adduct formation and carcinogenicity has been investigated for a number of carcinogenic and non-carcinogenic PAHs using an in vitro system. Our results demonstrate that relatively high levels of DNA adducts can be produced by some non-carcinogenic PAHs, while other non-carcinogenic compounds do not produce detectable adducts. In addition, it has been shown that all carcinogenic PAHs investigated produce DNAadducts and that a relationship exists between relative adduct formation and carcinogenic potency. An investigation of adduct levels in fish liver and crustacean hepatopancreas in Oxley Ck, Brisbane has shown that higher than expected DNA adduct levels were correlated with the presence of carcinogenic and noncarcinogenic PAHs with high relative adduct forming potential.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We have utilised the combination of sensitivity and specificity afforded by coupling high-performance liquid chromatography (HPLC) to a tandem mass spectrometer (MS-MS) to produce an assay which is suitable for assaying glutathione (GSH) concentrations in liver tissue. The sensitivity suggests it may also be suitable for extrahepatic tissues, The method has been validated for GSH using mouse liver samples and also allows the assay of GSSG. The stability of GSH under conditions relevant to the assay has been determined. A 20-mul amount of a diluted methanol extract of tissue is injected with detection limits of 0.2 pmol for GSH and 2 pmol for GSSG. The HPLC uses an Altima C-18 (150X4.6 mm, 5 mum) column at 35 degreesC. Chromatography utilises a linear gradient from 0 to 10% methanol in 0.1% formic acid over 5 min, with a final isocratic stage holding at 10% methanol for 5 min. Total flow rate is 0.8 ml/min. The transition from the M+H ion (308.1 m/z for GSH, and 613.3 m/z for GSSG) to the 162.0 m/z (GSH) and 355.3 m/z (GSSG) fragments are monitored. (C) 2001 Elsevier Science B.V. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A laboratory scale sequencing batch reactor (SBR) operating for enhanced biological phosphorus removal (EBPR) and fed with a mixture of volatile fatty acids (VFAs) showed stable and efficient EBPR capacity over a four-year-period. Phosphorus (P), poly-beta-hydroxyalkanoate (PHA) and glycogen cycling consistent with classical anaerobic/aerobic EBPR were demonstrated with the order of anaerobic VFA uptake being propionate, acetate then butyrate. The SBR was operated without pH control and 63.67+/-13.86 mg P l(-1) was released anaerobically. The P% of the sludge fluctuated between 6% and 10% over the operating period (average of 8.04+/-1.31%). Four main morphological types of floc-forming bacteria were observed in the sludge during one year of in-tensive microscopic observation. Two of them were mainly responsible for anaerobic/aerobic P and PHA transformations. Fluorescence in situ hybridization (FISH) and post-FISH chemical staining for intracellular polyphosphate and PHA were used to determine that 'Candidatus Accumulibacter phosphatis' was the most abundant polyphosphate accumulating organism (PAO), forming large clusters of coccobacilli (1.0-1.5 mum) and comprising 53% of the sludge bacteria. Also by these methods, large coccobacillus-shaped gammaproteobacteria (2.5-3.5 mum) from a recently described novel cluster were glycogen-accumulating organisms (GAOs) comprising 13% of the bacteria. Tetrad-forming organisms (TFOs) consistent with the 'G bacterium' morphotype were alphaproteobacteria , but not Amaricoccus spp., and comprised 25% of all bacteria. According to chemical staining, TFOs were occasionally able to store PHA anaerobically and utilize it aerobically.