Generic delimitation and phylogenetic uncertainty: An example from a group that has undergone an explosive radiation

Phylogenetic trees can provide a stable basis for a higher-level classification of organisms that reflects evolutionary relationships. However, some lineages have a complex evolutionary history that involves explosive radiation or hybridisation. Such histories have become increasingly apparent with the use of DNA sequence data for phylogeny estimation and explain, in part, past difficulties in producing stable morphology-based classifications for some groups. We illustrate this situation by using the example of tribe Mirbelieae (Fabaceae), whose generic classification has been fraught for decades. In particular, we discuss a recent proposal to combine 19 of the 25 Mirbelieae genera into a single genus, Pultenaea sens. lat., and how we might find stable and consistent ways to squeeze something as complex as life into little boxes for our own convenience. © CSIRO.

Bush peas: a rapid radiation with no support for monophyly of Pultenaea (Fabaceae : Mirbelieae)

Phylogenetic hypotheses are presented for Pultenaea based on cpDNA (trnL-F and ndhF) and nrDNA ( ITS) sequence data. Pultenaea, as it is currently circumscribed, comprises six strongly supported lineages whose relationships with each other and 18 closely related genera are weak or conflicting among datasets. The lack of resolution among the six Pultenaea clades and their relatives appears to be the result of a rapid radiation, which is evident in molecular data from both the chloroplast and nuclear genomes. The molecular data provide no support for the monophyly of Pultenaea as it currently stands. Given these results, Pultenaea could split into many smaller genera. We prefer the taxonomically stable alternative of subsuming all 19 genera currently recognised in Pultenaea sensu lato (= the Mirbelia group) into an expanded concept of Pultenaea that would comprise similar to 470 species.

Identification of novel non-autonomous CemaT transposable elements and evidence of their mobility within the C. elegans genome

We describe here two new transposable elements, CemaT4 and CemaT5, that were identified within the sequenced genome of Caenorhabditis elegans using homology based searches. Five variants of CemaT4 were found, all non-autonomous and sharing 26 bp inverted terminal repeats (ITRs) and segments (152-367 bp) of sequence with similarity to the CemaT1 transposon of C. elegans. Sixteen copies of a short, 30 bp repetitive sequence, comprised entirely of an inverted repeat of the first 15 bp of CemaT4's ITR, were also found, each flanked by TA dinucleotide duplications, which are hallmarks of target site duplications of mariner-Tc transposon transpositions. The CemaT5 transposable element had no similarity to maT elements, except for sharing identical ITR sequences with CemaT3. We provide evidence that CemaT5 and CemaT3 are capable of excising from the C. elegans genome, despite neither transposon being capable of encoding a functional transposase enzyme. Presumably, these two transposons are cross-mobilised by an autonomous transposon that recognises their shared ITRs. The excisions of these and other non-autonomous elements may provide opportunities for abortive gap repair to create internal deletions and/or insert novel sequence within these transposons. The influence of non-autonomous element mobility and structural diversity on genome variation is discussed.

Review of genetic and epigenetic alterations in hepatocarcinogenesis

Hepatocellular carcinoma (HCC) is associated with multiple risk factors and is believed to arise from pre-neoplastic lesions, usually in the background of cirrhosis. However, the genetic and epigenetic events of hepatocarcinogenesis are relatively poorly understood. HCC display gross genomic alterations, including chromosomal instability (CIN), CpG island methylation, DNA rearrangements associated with hepatitis B virus (HBV) DNA integration, DNA hypomethylation and, to a lesser degree, microsatellite instability. Various studies have reported CIN at chromosomal regions, 1p, 4q, 5q, 6q, 8p, 10q, 11p, 16p, 16q, 17p and 22q. Frequent promoter hypermethylation and subsequent loss of protein expression has also been demonstrated in HCC at tumor suppressor gene (TSG), p16, p14, p15, SOCS1, RIZ1, E-cadherin and 14-3-3 sigma. An interesting observation emerging from these studies is the presence of a methylator phenotype in hepatocarcinogenesis, although it does not seem advantageous to have high levels of microsatellite instability. Methylation also appears to be an early event, suggesting that this may precede cirrhosis. However, these genes have been studied in isolation and global studies of methylator phenotype are required to assess the significance of epigenetic silencing in hepatocarcinogenesis. Based on previous data there are obvious fundamental differences in the mechanisms of hepatic carcinogenesis, with at least two distinct mechanisms of malignant transformation in the liver, related to CIN and CpG island methylation. The reason for these differences and the relative importance of these mechanisms are not clear but likely relate to the etiopathogenesis of HCC. Defining these broad mechanisms is a necessary prelude to determine the timing of events in malignant transformation of the liver and to investigate the role of known risk factors for HCC.

Report of the equine herpesvirus-1 Havermeyer Workshop, San Gimignano, Tuscany, June 2004

Amongst the infectious diseases that threaten equine health, herpesviral infections remain a world wide cause of serious morbidity and mortality. Equine herpesvirus-1 infection is the most important pathogen, causing an array of disorders including epidemic respiratory disease abortion, neonatal foal death, myeloencephalopathy and chorioretinopathy. Despite intense scientific investigation, extensive use of vaccination, and established codes of practice for control of disease outbreaks, infection and disease remain common. While equine herpesvirus-1 infection remains a daunting challenge for immunoprophylaxis, many critical advances in equine immunology have resulted in studies of this virus, particularly related to MHC-restricted cytotoxicity in the horse. A workshop was convened in San Gimignano, Tuscany, Italy in June 2004, to bring together clinical and basic researchers in the field of equine herpesvirus-1 study to discuss the latest advances and future prospects for improving our under-standing of these diseases, and equine immunity to herpesviral infection. This report highlights the new information that was the focus of this workshop, and is intended to summarize this material and identify the critical questions in the field. (c) 2006 Elsevier B.V. All rights reserved.

The assessment of oral cytology utilizing ploidy analysis and virtual microscopy for the early detection of epithelial dysplasia and neoplasia in oral mucosal lesions

Oral squamous cell carcinoma (OSCC) is associated with high morbidity and mortality which is due, at least in part, to late detection. Precancerous and cancerous oral lesions may mimic any number of benign oral lesions, and as such may be left without investigation and treatment until they are well advanced. Over the past several years there has been renewed interest in oral cytology as an adjuvant clinical tool in the investigation of oral mucosal lesions. The purpose of the present study was to compare the usefulness of ploidy analysis after Feulgen stained cytological thin-prep specimens with traditional incisional biopsy and routine histopathological examination for the assessment of the pre-malignant potential of oral mucosal lesions. An analysis of the cytological specimens was undertaken with virtual microscopy which allowed for rapid and thorough analysis of the complete cytological specimen. 100 healthy individuals between 30 and 70 years of age, who were non-smokers, non-drinkers and not taking any medication, had cytological specimens collected from both the buccal mucosa and lateral margin of tongue to establish normal cytology parameters within a control population. Patients with a presumptive clinical diagnosis of lichen planus, leukoplakia or OSCC had lesional cytological samples taken prior to their diagnostic biopsy. Standardised thin preparations were prepared and each specimen stained by both Feuglen and Papanicolau methods. High speed scanning of the complete slide at 40X magnification was undertaken using the Aperio Scanscope TM and the green channel of the resultant image was analysed after threshold segmentation to isolate only nuclei and the integrated optical density of each nucleus taken as a gross measure of the DNA content (ploidy). Preliminary results reveal that ploidy assessment of oral cytology holds great promise as an adjunctive prognostic factor in the analysis of the malignant potential of oral mucosal lesions.

The systematics and biology of the south African gall-inducing scale insect, Calycicoccus merwei brain (Hemiptera : Coccoidea : Eriococcidae)

The scale insect genus Calycicoccus Brain has a single described species, C. merwei Brain, which is endemic to southeastern South Africa. Females of C. merwei induce small, mostly conical galls on the foliage of their host tree, Apodytes dimidiata E. Meyer ex Arn. (Icacinaceae), which has a wider, mostly coastal distribution, than that currently known for the scale insect. Calycicoccus has been placed in the family Eriococcidae and may be related to the South American genus Aculeococcus Lepage. No other native eriococcid species have been described so far in South Africa, although the family is diverse in other Gondwanan regions. This paper summarizes the biology of C. merwei, redescribes the adult female, describes the adult male, the second-instar female and the first-instar nymphs for the first time, and reconsiders the phylogenetic relationships of the genus. The adult female is shown to have unusual abdominal segmentation, in that segment I is present both dorsally and ventrally, but a segment is absent ventrally on the middle abdomen. First-instar nymphs are sexually dimorphic; males have a larger and relatively narrower body, larger mouthparts, longer antennae and legs, and more thoracic dorsal setae compared with females. Molecular data from nuclear small-subunit ribosomal DNA (18S) and elongation factor 1 alpha (EF-1a) show C. merwei to have no close relatives among the Eriococcidae sampled to date. Instead, the Calycicoccus lineage is part of a polytomy near the base of the Eriococcidae. Molecular dating of the node suggests that the Calycicoccus lineage diverged from other eriococcids more than 100 Mya. These data support the placement of Calycicoccus as the only genus in the subfamily Calycicoccinae Brain.

Binding and internalization of the melanocyte stimulating hormone receptor ligand [Nle(4), D-Phe(7)]alpha-MSH in B16 melanoma cells

The current study aims to ascertain the fate of the melanocyte stimulating hormone (MSH) receptor and its ligand [Nle(4), D-Phe(7)]alpha-MsH (NDP-MSH) following binding to murine B16 melanoma cells. Cells were incubated with [I-125]-NDP-MSH for up to 180 min and binding, internalization and degradation determined. Intracellular trafficking of the radiolabel was assessed !using Percoll density gradient centrifugation of homogenized cells. Receptor down-regulation and receptor mRNA levels were also measured over 96 hr after exposure to 1 mu M ligand. NDP-MSH accumulation increased with time in a temperature-dependent manner and was inhibited by excess peptide. The ligand was rapidly internalized and translocated to the lysosomal compartment where it was degraded. Internalization was accompanied by a loss or down-regulation of cell surface receptors, suggesting internalization of the NDP-MSH-receptor complex. No recycling of the receptors between the plasma membrane and intracellular compartments could be detected in this cell-hue. Approximately 15% of the surface receptors were resistant to down-regulation, possibly indicating receptor heterogeneity. Down-regulation persisted ibr up to 96 hr and was accompanied by a decrease in MSH receptor mRNA levels 48 hr after treatment. However, before this time, transcript levels were the same in treated and control cells. In contrast to what was seen with NDP-MSH, cell surface receptors removed with trypsin wc:re rapidly replaced. These results show that NDP-MSH not only induced MSH receptor :internalization but also inhibited receptor turnover, resulting in a prolonged down-regulation. It is concluded that, in B16 cells, the MSH receptor undergoes ligand-dependent internalization, resulting in a prolonged down-regulation. Copyright (C) 1996 Elsevier Science Ltd

New gene technologies and their potential value for sugarcane

An efficient system is now in place for improving diverse sugarcane cultivars by genetic transformation, that is, the insertion of useful new genes into single cells followed by the regeneration of genetically modified (transgenic) plants. The method has already been used to introduce genes for resistance to several major diseases, insect pests and a herbicide, Field testing has begun, and research is underway to identify other genes for increased environmental stress resistance, agronomic efficiency and yield of sucrose or other valuable products. Experience in other crops has shown that genetically improved varieties which provide genuine environmental and consumer benefits are welcomed by producers and consumers. Substantial research is still needed, but these new gene technologies will reshape the sugar industry and determine the international competitive efficiency of producers.

Super-CHO - A cell line capable of autocrine growth under fully defined protein-free conditions

Chinese Hamster Ovary (CHO) cells are widely used for the large scale production of recombinant biopharmaceuticals. Growth of the CHO-K1 cell line has been demonstrated in serum-free medium containing insulin, transferrin and selenium. In an attempt to get autocrine growth in protein-free medium, DNA coding for insulin and transferrin production was transfected into CHO-K1 cells. Transferrin was expressed well, with clones secreting approximately 1000 ng/10(6)cells/24h. Insulin was poorly expressed, with rates peaking at 5 ng/10(6)cells/24h. Characterisation of the secreted insulin indicated that the CHO cells were incompletely processing the insulin molecule. Site-directed mutagenesis was used to introduce a furin (prohormone converting enzyme) recognition sequence into the insulin molecule, allowing the production of active insulin. However, the levels were still too low to support autocrine growth. Further investigations revealed insulin degrading activity (presumably due to the presence of insulin degrading enzymes) in the cytoplasm of CHO cells. To overcome these problems insulin-like growth factor I (instead of insulin) was transfected into the cells. IGF-1 was completely processed and expressed at rates greater than 500 ng/10(6)cells/24h. In this paper we report autonomous growth of the transfected CHO-K1 cell line expressing transferrin and IGF-1 in protein-free medium without the addition of exogenous growth factors. Growth rates and final cell densities of these cells were identical to that of the parent cell line CHO-K1 growing in insulin, transferrin, and selenium supplemented serum-free media.

Insertion/deletion polymorphism of the angiotensin converting enzyme gene and loss of the insertion allele in aldosterone-producing adenoma

The genetic mechanisms responsible for the formation of adrenocortical adenomas which autonomously produce aldosterone are largely unknown, The adrenal renin-angiotensin system has been implicated in the pathophysiology of these tumours, Angiotensin-converting enzyme (ACE) catalyses the generation of angiotensin II, and the insertion/deletion (I/D) polymorphism of the ACE gene regulates up to 50% of plasma and cellular ACE variability in humans. We therefore examined the genotypic and allelic frequency distributions of the ACE gene I/D polymorphism in 55 patients with aldosterone-producing adenoma, APA, (angiotensin-unresponsive APA n = 28, angiotensin-responsive APA n = 27), and 80 control subjects with no family history of hypertension, We also compared the ACE gene I/D polymorphism allelic pattern in matched tumour and peripheral blood DNA in the 55 patients with APA, The frequency of the D allele was 0.518 and 0.512 and the I allele was 0.482 and 0.488 in the APA and control subjects respectively, Genotypic and allelic frequency analysis found no significant differences between the groups, Examination of the matched tumour and peripheral blood DNA samples revealed the loss of the insertion allele in four of the 25 patients who were heterozygous for the ACE I/D genotype. The I/D polymorphism of the ACE gene does not appear to contribute to the biochemical and phenotypic characteristics of APA, however, the deletion of the insertion allele of the ACE gene I/D polymorphism in 16% of aldosterone-producing adenomas may represent the loss of a tumour suppressor gene/s or other genes on chromosome 17q which may contribute to tumorigenesis in APA.

Identification and characterization of a G protein-coupled receptor homolog encoded by murine cytomegalovirus

This report describes the identification of a murine cytomegalovirus (MCMV) G protein-coupled receptor (GCR) homolog. This open reading frame (M33) is most closely related to, and collinear with, human cytomegalovirus UL33, and homologs are also present in human herpesvirus 6 and 7 (U12 for both viruses). Conserved counterparts in the sequenced alpha- or gammaherpesviruses have not been identified to date, suggesting that these genes encode proteins which are important for the biological characteristics of betaherpesviruses. We have detected transcripts for both UL33 and M33 as early as 3 or 4 h postinfection, and these reappear at late times. In addition, we have identified N-terminal splicing for both the UL33 and M33 RNA transcripts. For both open reading frames, splicing results in the introduction of amino acids which are highly conserved among known GCRs. To characterise the function of the M33 in the natural host, two independent MCMV recombinant viruses were prepared, each of which possesses an M33 open reading frame which has been disrupted with the beta-galactosidase gene. While the recombinant M33 null viruses showed no phenotypic differences in replication from wild-type MCMV in primary mouse embryo fibroblasts in vitro, they showed severely restricted growth in the salivary glands of infected mice. These data suggest that M33 plays an important role in vivo, in particular in the dissemination to or replication in the salivary gland, and provide the first evidence for the function of a viral GCR homolog in vivo.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).