An object-oriented neural network approach to short-term traffic forecasting

This paper discusses an object-oriented neural network model that was developed for predicting short-term traffic conditions on a section of the Pacific Highway between Brisbane and the Gold Coast in Queensland, Australia. The feasibility of this approach is demonstrated through a time-lag recurrent network (TLRN) which was developed for predicting speed data up to 15 minutes into the future. The results obtained indicate that the TLRN is capable of predicting speed up to 5 minutes into the future with a high degree of accuracy (90-94%). Similar models, which were developed for predicting freeway travel times on the same facility, were successful in predicting travel times up to 15 minutes into the future with a similar degree of accuracy (93-95%). These results represent substantial improvements on conventional model performance and clearly demonstrate the feasibility of using the object-oriented approach for short-term traffic prediction. (C) 2001 Elsevier Science B.V. All rights reserved.

Perturbed upper limb movements cause short-latency postural responses in trunk muscles

Addition of a load to a moving upper limb produces a perturbation of the trunk due to transmission of mechanical forces. This experiment investigated the postural response of the trunk muscles in relation to unexpected limb loading. Subjects performed rapid, bilateral shoulder flexion in response to a stimulus. In one third of trials, an unexpected load was added bilaterally to the upper limbs in the first third of the movement. Trunk muscle electromyography, intra-abdominal pressure and upper limb and trunk motion were measured. A short-latency response of the erector spinae and transversus abdominis muscles occurred similar to 50 ms after the onset of the limb perturbation that resulted from addition of the load early in the movement and was coincident with the onset of the observed perturbation at the trunk. The results provide evidence of initiation of a complex postural response of the trunk muscles that is consistent with mediation by afferent input from a site distant to the lumbar spine, which may include afferents of the upper limb.

Prior calcium channel blockade and short-term survival following acute myocardial infarction

There is concern over the safety of calcium channel blockers (CCBs) in acute coronary disease. We sought to determine if patients taking calcium channel blockers (CCBs) at the time of admission with acute myocardial infarction (AMI) had a higher case-fatality compared with those taking beta-blockers or neither medication. Clinical and drug treatment variables at the time of hospital admission predictive of survival at 28 days were examined in a community-based registry of patients aged under 65 years admitted to hospital for suspected AMI in Perth, Australia, between 1984 and 1993. Among 7766 patients, 1291 (16.6%) were taking a CCB and 1259 (16.2%) a betablocker alone at hospital admission. Patients taking CCBs had a worse clinical profile than those taking a beta-blocker alone or neither drug (control group), and a higher unadjusted 28-day mortality (17.6% versus 9.3% and 11.1% respectively, both P < 0.001). There was no significant heterogeneity with respect to mortality between nifedipine, diltiazem, or verapamil when used alone, or with a beta-blocker. After adjustment for factors predictive of death at 28 days, patients taking a CCB were found not to have an excess chance of death compared with the control group (odds ratio [OR] 1.06, 95% confidence interval [CI]; 0.87, 1.30), whereas those taking a beta-blocker alone had a lower odds of death (OR 0.75, 95% CI; 0.59, 0.94). These results indicate that established calcium channel blockade is not associated with an excess risk of death following AMI once other differences between patients are taken into account, but neither does it have the survival advantage seen with prior beta-blocker therapy.

Myb-binding Protein 1a is a Nucleocytoplasmic Shuttling Protein that Utilizes CRM1-dependent and Independent Nuclear Export Pathways

Myb-binding protein 1a (Mybbp1a) is a novel nuclear protein localized predominantly, but not exclusively, in nucleoli. Although initially isolated as a c-Myb interacting protein, Mybbp1a is expressed ubiquitously, associates with a number of different transcription factors, and may play a role in both RNA polymerase I- and II-mediated transcriptional regulation. However, its precise function remains unclear. In this study we show that Mybbp1a is a nucleocytoplasmic shuttling protein and investigate the mechanisms responsible for both nuclear import and export. The carboxyl terminus of Mybbp1a, which contains seven short basic amino acid repeat sequences, is responsible for both nuclear and nucleolar localization, and this activity can be transferred to a heterologous protein. Deletion mapping demonstrated that these repeat sequences appear to act incrementally, with successive deletions resulting in a corresponding increase in the proportion of protein localized in the cytoplasm. Glutathione S-transferase pulldown experiments showed that the nuclear receptor importin-alpha/beta mediates Mybbp1a nuclear import. Interspecies heterokaryons were used to demonstrate that Mybbp1a was capable of shuttling between the nucleus and the cytoplasm. Deletion analysis and in vivo export studies using a heterologous assay system identified several nuclear export sequences which facilitate Mybbp1a nuclear export of Mybbp1a by CRM1-dependent and -independent pathways. (C) 2003 Elsevier Science (USA). All rights reserved.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Stimulating dormancy release and emergence of annual ryegrass (Lolium rigidum) seeds using short-term hydrated storage in darkness

Experiments were performed to determine whether the dormancy release effect of hydrated storage in darkness (dark-stratification) is common amongst annual ryegrass populations and has the potential to occur under field conditions. Dormant seeds from all populations tested (22) became sensitive to light during dark-stratification, enabling them to germinate when subsequently exposed to light. Under controlled temperature (25/15degreesC), light (12-h photoperiod), and hydration (solidified agar-water) conditions, more seeds germinated by 28 days if the first 14 days were in darkness followed by exposure to light for 12 h per day than if they were exposed to light throughout or darkness throughout. Constraint over the conditions imposed during dark-stratification and germination was gradually reduced to investigate whether the dormancy release effect was diminished. Dark-stratification was effective in promoting germination when performed under natural diurnal temperatures, and burial in moist soil provided suitable conditions for dark-stratification to occur. The surface of moist soil, with natural diurnal temperatures and sunlight, was suitable for germination of dark-stratified seeds. Dark-stratification is a quick and effective means to enhance the sensitivity of dormant annual ryegrass seeds to light, enabling the majority of the population to germinate. However, large quantities of light are required to promote germination of dark-stratified seeds, so buried seeds must be moved to the soil surface to allow exposure to adequate light for germination.

Identification of novel non-autonomous CemaT transposable elements and evidence of their mobility within the C. elegans genome

We describe here two new transposable elements, CemaT4 and CemaT5, that were identified within the sequenced genome of Caenorhabditis elegans using homology based searches. Five variants of CemaT4 were found, all non-autonomous and sharing 26 bp inverted terminal repeats (ITRs) and segments (152-367 bp) of sequence with similarity to the CemaT1 transposon of C. elegans. Sixteen copies of a short, 30 bp repetitive sequence, comprised entirely of an inverted repeat of the first 15 bp of CemaT4's ITR, were also found, each flanked by TA dinucleotide duplications, which are hallmarks of target site duplications of mariner-Tc transposon transpositions. The CemaT5 transposable element had no similarity to maT elements, except for sharing identical ITR sequences with CemaT3. We provide evidence that CemaT5 and CemaT3 are capable of excising from the C. elegans genome, despite neither transposon being capable of encoding a functional transposase enzyme. Presumably, these two transposons are cross-mobilised by an autonomous transposon that recognises their shared ITRs. The excisions of these and other non-autonomous elements may provide opportunities for abortive gap repair to create internal deletions and/or insert novel sequence within these transposons. The influence of non-autonomous element mobility and structural diversity on genome variation is discussed.

Short-term and long-term cardiovascular actions of different doses of perindopril in the rabbit

Short-term (one week) and chronic (six week) cardiovascular effects of orally administered perindopril were examined in the rabbit to demonstrate if short-term results can predict chronic outcomes. In short-term treatment, five doses of perindopril were examined in random order separated by a one week recovery period in each of six rabbits. Two doses of perindopril which resulted in a moderate hypotensive effect (-14 mmHg) and no hypotensive effect, respectively, were then selected for long-term treatment. Each rabbit in the short-term study received perindopril in doses of 0.01, 0.06, 0.32, 1.8 and 10 mg kg(-1) day(-1) for a week at a time. Rabbits on long-term treatment received either 0.3 or 0.01 mg kg(-1) day(-1) perindopril for six weeks. All rabbits had their mean arterial blood pressure (MAP) and heart rate recorded throughout treatment. Plasma angiotensin I (AngI), perindoprilat, angiotensin converting enzyme (ACE) inhibition were also assayed. Perindopril treatment for one week produced a dose-dependent hypotensive effect with the threshold dose, 0.06 mg kg(-1) day(-1), producing a 6.5+/-1.8 mmHg fall in MAP. The highest dose (10.0 mg kg(-1) day(-1)) produced a large fall in blood pressure of -29.6+/-4.2 mmHg. The 0.01 and 0.06 mg kg(-1) day(-1) doses of perindopril produced an average 2.65 fold increase in plasma AngI levels compared to the initial control. The three higher doses (0.32-10.0 mg kg(-1) day(-1)) of perindopril produced an equivalent 5.7 fold increase in plasma AngI levels compared to the initial controls. However, over six weeks 0.01 mg kg(-1) day(-1) perindopril induced a similar decrease in MAP as the 30 fold higher dose (-9.3 mmHg compared to -11.7 mmHg,). This was in spite of a 3 fold difference in plasma perindoprilat concentrations between the high and low dose perindopril groups. Plasma ACE inhibition was >80% with both doses of perindopril. The results indicate that while perindopril decreases MAP in a dose-dependent manner in short-term (one week) periods, over longer treatment times (six weeks) low concentrations of perindopril, non-hypotensive with shortterm treatment, may be as anti-hypertensive as considerably higher doses. (C) 1996 The Italian Pharmacological Society.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

The myosin-I-binding protein Acan125 binds the SH3 domain and belongs to the superfamily of leucine-rich repeat proteins

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.

Application of inter simple sequence repeat (ISSR) markers to plant genetics

Microsatellites or simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Single-locus SSR markers have been developed for a number of species, although there is a major bottleneck in developing SSR markers whereby flanking sequences must be known to design 5'-anchors for polymerase chain reaction (PCR) primers. Inter SSR (ISSR) fingerprinting was developed such that no sequence knowledge was required. Primers based on a repeat sequence, such as (CA)(n), can be made with a degenerate 3'-anchor, such as (CA)(8)RG or (AGC)(6)TY. The resultant PCR reaction amplifies the sequence between two SSRs, yielding a multilocus marker system useful for fingerprinting, diversity analysis and genome mapping. PCR products are radiolabelled with P-32 or P-33 via end-labelling or PCR incorporation, and separated on a polyacrylamide sequencing gel prior to autoradiographic visualisation. A typical reaction yields 20-100 bands per lane depending on the species and primer. We have used ISSR fingerprinting in a number of plant species, and report here some results on two important tropical species, sorghum and banana. Previous investigators have demonstrated that ISSR analysis usually detects a higher level of polymorphism than that detected with restriction fragment length polymorphism (RFLP) or random amplified polymorphic DNA (RAPD) analyses. Our data indicate that this is not a result of greater polymorphism genetically, but rather technical reasons related to the detection methodology used for ISSR analysis.