135 resultados para randomly amplified polymorphic DNA (RAPD)
Resumo:
Anthracnose, caused by Colletotrichum trifolii, is one of the most serious diseases influencing lucerne persistence and productivity in eastern Australia. The disease is largely controlled by plant resistance; however, new pathotypes of C. trifolii have developed in Australia, seriously limiting the productive life of susceptible cultivars. This paper describes an incompletely recessive and quantitatively inherited resistance to C. trifolii identified in a clone (W116) from cv. Sequel. S-1, F-1, F-2 and backcross populations of W116 and D (highly susceptible clone) were studied for their reaction to C. trifolii race 1. Resistance was found to be quantitatively inherited, and quantitative trait loci associated with resistance and susceptibility were identified in a backcross population (D x W116) x D using random amplified polymorphic DNA and amplified fragment length polymorphic markers. A multi-locus region on linkage group 4 was found to contribute significantly to the resistance phenotype. The application of DNA markers to allow exploitation of this quantitatively inherited resistance in lucerne breeding is discussed.
Resumo:
The Australian-bred lucerne cultivars, Trifecta and Sequel, were found to possess useful levels of resistance to both Colletotrichum trifolii races 1 and 2. Race 2 has only been previously observed in the United States and surveys did not reveal its presence in Australia. Multilocus fingerprinting using random amplified polymorphic DNA (RAPDs) analysis revealed low diversity (<10% dissimilarity) within Australian C. trifolii collections, and between the Australian race 1 isolates and a US race 2 isolate. Studies on the inheritance of resistance to C. trifolii race 1 in individual clones from Trifecta and Sequel revealed the presence of 2 different genetic mechanisms. One inheritance was for resistance as a recessive trait, and the other indicated that resistance was dominant. The recessive system has never been previously reported, whereas in the US, 2 completely dominant and independent tetrasomic genes Anl and Ant have been reported to condition C. trifolii resistance. It was not possible to fit the observed segregations from our studies to a single-gene model. In contrast to US studies, clones of cv. Sequel exhibiting the recessive resistance reacted differently to spray and stem injection with C. trifolii inoculum, being resistant to the former and susceptible to the latter, providing additional evidence for the presence of a different genetic mechanism conditioning resistance to those previously reported in the US. As C. trifolii is one of the most serious diseases of lucerne worldwide, the future development of molecular markers closely linked to the dominant and recessive resistances identified in these studies, and the relationships between these resistances and Anl and Ans as determined by genetic mapping, appear to be useful areas of future study.
Resumo:
Isolations from black stem lesions of sunflower growing in south-eastern Queensland yielded fungi putatively identified as species of Phoma. Pathogenicity assays showed that these isolates were capable of killing sunflower plants under glasshouse conditions. The isolates were compared with authentic cultures of Phoma macdonaldii and other isolates of Phoma taken from sunflower from around the world. Random amplified polymorphic DNA analysis showed that all the Australian isolates examined were very similar to the holotype culture of Phoma macdonaldii from Canada. Sequencing of the internal transcribed spacer regions also revealed the relatedness of the Australian isolates to the holotype. This is the first official record of P. macdonaldii in Australia.
Resumo:
DNA of Leifsonia xyli subsp. xyli (Lxx), the causal agent of ratoon stunting disease of sugarcane, was detected in the fibrovascular fluid of sugarcane plants using random amplified polymorphic DNA PCR-based amplification using two 10-mer oligonucleotide primers. The primers OPC-02 and OPC-11 produced Lxx-specific markers of approximately 800 bp and 1000 bp, respectively. A cloned DNA fragment from the 800 bp PCR product (pSKC2-800) hybridised to a single genomic DNA fragment from Lxx when used as a probe in Southern hybridisation. This cloned fragment did not hybridise to L. xyli subsp. cynodontis (Lxc), or L. xyli-like bacteria isolated from grasses in Australia, indicating the usefulness of this DNA fragment as a specific probe for Lxx. A cloned fragment from the 1000 bp PCR product ( pSKC11-1000) hybridised to three genomic fragments in Lxx isolates, one genomic fragment in two of the four isolates of L. xyli-like bacteria, and in two of the four isolates of Lxc isolated from the USA. These results indicate that L. xyli-like bacteria are more likely to be related to Lxc than Lxx. These probes did not hybridise to the DNA from strains of the species of Clavibacter, Rathayibacter, Acidovorax, Ralstonia, Pseudomonas and Xanthomonas tested. Two oligonucleotide primers (21-mer) designed from the pSKC2-800 sequences specifically amplified template DNA from Lxx and detected as few as 5 x 10(4) cells/mL in fibrovascular fluid from sugarcane plants infected with Lxx.
Resumo:
Phytophthora cinnamomi isolates from South Africa and Australia were compared to assess genetic differentiation between the two populations. These two populations were analysed for levels of phenotypic diversity using random amplified polymorphic DNAs (RAPDs) and gene and genotypic diversity using restriction fragment length polymorphisms (RFLPs). Sixteen RAPD markers from four decanucleotide Operon primers and 34 RFLP alleles from 15 putative loci were used. A few isolates from Papua New Guinea known to posses alleles different from Australian isolates were also included for comparative purposes. South African and Australian P. cinnamomi populations were almost identical with an extremely low level of genetic distance between them (D-m = 0.003). Common features for the two populations include shared alleles, low levels of phenotypic/genotypic diversity, high clonality, and low observed and expected levels of heterozygosity. Furthermore, relatively high levels of genetic differentiation between mating type populations (D-m South Africa = 0.020 and D-m Australia = 0.025 respectively), negative fixation indices, and significant deviations from Hardy-Weinberg equilibrium, all provided evidence for the lack of frequent sexual reproduction in both populations. The data strongly suggest that both the South African and Australian P. cinnamomi populations are introduced.
Resumo:
Existing procedures for the generation of polymorphic DNA markers are not optimal for insect studies in which the organisms are often tiny and background molecular Information is often non-existent. We have used a new high throughput DNA marker generation protocol called randomly amplified DNA fingerprints (RAF) to analyse the genetic variability In three separate strains of the stored grain pest, Rhyzopertha dominica. This protocol is quick, robust and reliable even though it requires minimal sample preparation, minute amounts of DNA and no prior molecular analysis of the organism. Arbitrarily selected oligonucleotide primers routinely produced similar to 50 scoreable polymorphic DNA markers, between individuals of three Independent field isolates of R. dominica. Multivariate cluster analysis using forty-nine arbitrarily selected polymorphisms generated from a single primer reliably separated individuals into three clades corresponding to their geographical origin. The resulting clades were quite distinct, with an average genetic difference of 37.5 +/- 6.0% between clades and of 21.0 +/- 7.1% between individuals within clades. As a prelude to future gene mapping efforts, we have also assessed the performance of RAF under conditions commonly used in gene mapping. In this analysis, fingerprints from pooled DNA samples accurately and reproducibly reflected RAF profiles obtained from Individual DNA samples that had been combined to create the bulked samples.
Resumo:
The I-3 gene from the wild tomato species Lycopersicon pennellii confers resistance to race 3 of the devastating vascular wilt pathogen Fusarium oxysporum f. sp. lycopersici. As an initial step in a positional cloning strategy for the isolation of I-3, we converted restriction fragment length polymorphism and conserved orthologue set markers, known genes and a resistance gene analogue (RGA) mapping to the I-3 region into PCR-based sequence characterised amplified region (SCAR) and cleaved amplified polymorphic sequence (CAPS) markers. Additional PCR-based markers in the I-3 region were generated using the randomly amplified DNA fingerprinting (RAF) technique. SCAR, CAPS and RAF markers were used for high-resolution mapping around the I-3 locus. The I-3 gene was localised to a 0.3-cM region containing a RAF marker, eO6, and an RGA, RGA332. RGA332 was cloned and found to correspond to a putative pseudogene with at least two loss-of-function mutations. The predicted pseudogene belongs to the Toll interleukin-1 receptor-nucleotide-binding site-leucine-rich-repeat sub-class of plant disease resistance genes. Despite the presence of two RGA332 homologues in L. esculentum, DNA gel blot and PCR analysis suggests that no other homologues are present in lines carrying I-3 that could be alternative candidates for the gene.
Resumo:
The novel molecular marker technique Randomly Amplified DNA Fingerprinting (RAF) was used to survey genetic relationships between 37 accessions of the tropical fruit G. mangostana (mangosteen) and among 11 accessions from eight other Garcinia species. Although mangosteen is believed to reproduce exclusively through apomixis, our results show that considerable genetic diversity exists within G. mangostana and between other Garcinia species. Among the 37 G. mangostana accessions examined, nine different genotypes were identified which clustered into three distinct groups based on correspondence analysis (reciprocal averaging). For 26 (70%) of the accessions no marker variation was detected over 530 loci screened. A further eight (22%) accessions exhibited very low levels of variation (0.2-1%) suggesting at least one well conservedm angosteen genotype. The remaining three accessions (8%) showed extensive variation (22-31%) compared with the majority of accessions. The three mangosteen groups were 63-70% dissimilar to the other Garcinia species investigated. The genetic diversity identified in this research will assist in the conservation of Garcinia germplasm and provides a valuable framework for the genetic improvement of mangosteen.
Resumo:
EDD (E3 isolated by differential display), located at chromosome 8q22.3, is the human orthologue of the Drosophila melanogaster tumour suppressor gene 'hyperplastic discs' and encodes a HECT domain E3 ubiquitin protein-ligase. To investigate the possible involvement of EDD in human cancer, several cancers from diverse tissue sites were analysed for allelic gain or loss (allelic imbalance, AI) at the EDD locus using an EDD-specific microsatellite, CEDD, and other polymorphic microsatellites mapped in the vicinity of the 8q22.3 locus. Of 143 cancers studied, 38 had AI at CEDD (42% of 90 informative cases). In 14 of these cases, discrete regions of imbalance encompassing 8q22.3 were present, while the remainder had more extensive 8q aberrations. AI of CEDD was most frequent in ovarian cancer (22/47 informative cases, 47%), particularly in the serous subtype (16/22, 73%), but was rare in benign and borderline ovarian tumours. AI was also common in breast cancer (31%), hepatocellular carcinoma (46%), squamous cell carcinoma of the tongue (50%) and metastatic melanoma (18%). AI is likely to represent amplification of the EDD gene locus rather than loss of heterozygosity, as quantitative RT-PCR and immunohistochemistry showed that EDD mRNA and protein are frequently overexpressed in breast and ovarian cancers, while among breast cancer cell lines EDD overexpression and increased gene copy number were correlated. These results demonstrate that AI at the EDD locus is common in a diversity of carcinomas and that the EDD gene is frequently overexpressed in breast and ovarian cancer, implying a potential role in cancer progression.
Resumo:
Six Burkholderia solanacearum (formerly Pseudomonas solanacearum) genomic DNA fragments were isolated, using RAPD techniques and cloning, from the three genetically diverse strains: ACH092 (Biovar 4), ACH0158 (Biovar 2) and ACH0171 (Biovar 3) (1). One of these cloned fragments was selected because it was present constantly in all bacterial strains analysed. The remaining five clones were selected because Southern hybridisation revealed that each showed partial or complete specificity towards the strain of origin. A seventh genomic fragment showing a strain-specific distribution in Southern hybridisations was obtained by differential restriction, hybridisation and cloning of genomic DNA. Each of these clones was sequenced and primers to amplify the insert were designed. When DNA from the strain of origin was used as template, PCR amplification for each of these fragments yielded a single band on gel analysis. One pair of primers amplified the species-constant fragment of 281 bp from DNA of all B. solanacearum strains investigated, from DNA of the closely related bacterium which causes ''blood disease'' of banana (BDB) and in P. syzigii. The sensitivity of detection of B. solanacearum using these ubiquitous primers was between 1.3 and 20 bacterial cells. The feasibility and reliability of a PCR approach to detection and identification of B. solanacearum was tested in diverse strains of the bacterium in several countries and laboratories.
Resumo:
The virulence spectrum of 112 isolates of Phytophthora clandestina collected from 56 sites in four subterranean clover-growing states in southern Australia was determined using differential cultivars of subterranean clover. Five races were detected, with race 0 in all states except New South Wales, race 1 in all states, race 2 only in Victoria, race 3 only in New South Wales, and race 4 in Victoria and Western Australia. The level of genotypic diversity among the different P. clandestina populations was investigated using five RAPD primers. Among 30 bands amplified, only two were polymorphic. This enabled identification of four multilocus RAPD genotypes. Three of the four genotypes occurred in all four states. Races 2 and 3 occurred with RAPD genotypes 1 and 2 only whereas races 0 and 1 occurred in all four multilocus RAPD genotypes. These results indicate that the pathogenicity spectrum of P. clandestina can change rapidly.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Microsatellites are difficult to recover from large plant genomes so cross-specific utilisation is an important source of markers. Fifty micro satellites were tested for cross-specific amplification and polymorphism to two New World hard pine species, slash pine (Pinus elliottii var. elliottii) and Caribbean pine (R caribaea var. hondurensis). Twenty-nine (58%) markers amplified in both hard pine species, and 23 of these 29 were polymorphic. Soft pine (subgenus Strobus) microsatellite markers did amplify, but none were polymorphic. Pinus elliottii var. elliottii and R caribaea var. hondurensis showed mutational changes in the flanking regions and the repeat motif that were informative for Pinus spp. phylogenetic relationships. Most allele length variation could be attributed to variability in repeat unit number. There was no evidence for ascertainment bias.
Resumo:
Molecular breeding is becoming more practical as better technology emerges. The use of molecular markers in plant breeding for indirect selection of important traits can favorably impact breeding efficiency. The purpose of this research is to identify quantitative trait loci (QTL) on molecular linkage groups (MLG) which are associated with seed protein concentration, seed oil concentration, seed size, plant height, lodging, and maturity, in a population from a cross between the soybean cultivars 'Essex' and 'Williams.' DNA was extracted from F-2 generation soybean leaves and amplified via polymerase chain reaction (PCR) using simple sequence repeat (SSR) markers. Markers that were polymorphic between the parents were analyzed against phenotypic trait data from the F-2 and F-4:6 generation. For the F-2 population, significant additive QTL were Satt540 (MLG M, maturity, r(2)=0.11; height, r(2)=0.04, seed size, r(2)=0.061, Satt373 (MLG L, seed size, r(2)=0.04; height, r(2)=0.14), Satt50 (MLG A1, maturity r(2)=0.07), Satt14 (MLG D2, oil, r(2)=0.05), and Satt251 (protein r(2)=0.03, oil, r(2)=0.04). Significant dominant QTL for the F-2 population were Satt540 (MLG M, height, r(2)=0.04; seed size, r(2)=0.06) and Satt14 (MLG D2, oil, r(2)=0.05). In the F-4:6 generation significant additive QTL were Satt239 (MLG I, height, r(2)=0.02 at Knoxville, TN and r(2)=0.03 at Springfield, TN), Satt14 (MLG D2, seed size, r(2)=0.14 at Knoxville, TN), Satt373 (MLG L, protein, r(2)=0.04 at Knoxville, TN) and Satt251 (MLG B I, lodging r(2)=0.04 at Springfield, TN). Averaged over both environments in the F-4:6 generation, significant additive QTL were identified as Satt251 (MLG B 1, protein, r(2)=0.03), and Satt239 (MLG 1, height, r(2)=0.03). The results found in this study indicate that selections based solely on these QTL would produce limited gains (based on low r(2) values). Few QTL were detected to be stable across environments. Further research to identify stable QTL over environments is needed to make marker-assisted approaches more widely adopted by soybean breeders.