152 resultados para random amplified polymorphic DNA


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cylindrospermopsis raciborskii is a toxic-bloom-forming cyanobacterium that is commonly found in tropical to subtropical climatic regions worldwide, but it is also recognized as a common component of cyanobacterial communities in temperate climates. Genetic profiles of C. raciborskii were examined in 19 cultured isolates originating from geographically diverse regions of Australia and represented by two distinct morphotypes. A 609-bp region of rpoC1, a DNA-dependent RNA polymerase gene, was amplified by PCR from these isolates with cyanobacterium-specific primers. Sequence analysis revealed that all isolates belonged to the same species, including morphotypes with straight or coiled trichomes. Additional rpoC1 gene sequences obtained for a range of cyanobacteria highlighted clustering of C. raciborskii with other heterocyst-producing cyanobacteria (orders Nostocales and Stigonematales). In contrast, randomly amplified polymorphic DNA and short tandemly repeated repetitive sequence profiles revealed a greater level of genetic heterogeneity among C. raciborskii isolates than did rpoC1 gene analysis, and unique band profiles were also found among each of the cyanobacterial genera examined. A PCR test targeting a region of the rpoC1 gene unique to C. raciborskii was developed for the specific identification of C. raciborskii from both purified genomic DNA and environmental samples. The PCR was evaluated with a number of cyanobacterial isolates, but a PCR-positive result was only achieved with C, raciborskii. This method provides an accurate alternative to traditional morphological identification of C. raciborskii.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Various marker systems exist for genetic analysis of horticultural species. Isozymes were first applied to the woody perennial nut crop, macadamia, in the early 1990s. The advent of DNA markers saw the development, for macadamia, of STMS (sequence-tagged microsatellite site), RAPD (randomly amplified polymorphic DNA), and RAF (randomly amplified DNA fingerprinting). The RAF technique typically generates dominant markers, but within the dominant marker profiles, certain primers also amplify multi-allelic co-dominant markers that are suspected to be microsatellites. In this paper, we confirm this for one such marker, and describe how RAF primers can be chosen that amplify one or more putative microsatellites. This approach of genotyping anonymous microsatellite markers via RAF is designated RAMiFi (randomly amplified microsatellite fingerprinting). Several marker systems were compared for the type, amount, and cost-efficiency of the information generated, using data from published studies on macadamia. The markers were also compared for the way they clustered a common set of accessions. The RAMiFi approach was identified as the most efficient and economical. The availability of such a versatile tool offers many advantages for the genetic characterisation of horticultural species.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pine beauty moth, Panolis flammea (Denis & Schiffermuller), is a recent but persistent pest of lodgepole pine plantations in Scotland, but exists naturally at low levels within remnants and plantations of Scots pine. To test whether separate host races occur in lodgepole and Scots pine stands and to examine colonization dynamics, allozyme, randomly amplified polymorphic DNA (RAPD) and mitochondrial variation were screened within a range of Scottish samples. RAPD analysis indicated limited long distance dispersal (F-ST=0.099), and significant isolation by distance (P < 0.05); but that colonization between more proximate populations was often variable, from extensive to limited exchange. When compared with material from Germany, Scottish samples were found to be more diverse and significantly differentiated for all markers. For mtDNA, two highly divergent groups of haplotypes were evident, one group contained both German and Scottish samples and the other was predominantly Scottish. No genetic differentiation was evident between P. flammea populations sampled from different hosts, and no diversity bottleneck was observed in the lodgepole group. Indeed, lodgepole stands appear to have been colonized on multiple occasions from Scots pine sources and neighbouring populations on different hosts are close to panmixia.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Existing procedures for the generation of polymorphic DNA markers are not optimal for insect studies in which the organisms are often tiny and background molecular Information is often non-existent. We have used a new high throughput DNA marker generation protocol called randomly amplified DNA fingerprints (RAF) to analyse the genetic variability In three separate strains of the stored grain pest, Rhyzopertha dominica. This protocol is quick, robust and reliable even though it requires minimal sample preparation, minute amounts of DNA and no prior molecular analysis of the organism. Arbitrarily selected oligonucleotide primers routinely produced similar to 50 scoreable polymorphic DNA markers, between individuals of three Independent field isolates of R. dominica. Multivariate cluster analysis using forty-nine arbitrarily selected polymorphisms generated from a single primer reliably separated individuals into three clades corresponding to their geographical origin. The resulting clades were quite distinct, with an average genetic difference of 37.5 +/- 6.0% between clades and of 21.0 +/- 7.1% between individuals within clades. As a prelude to future gene mapping efforts, we have also assessed the performance of RAF under conditions commonly used in gene mapping. In this analysis, fingerprints from pooled DNA samples accurately and reproducibly reflected RAF profiles obtained from Individual DNA samples that had been combined to create the bulked samples.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

High levels of inheritable resistance to phosphine in Rhyzopertha dominica have recently, been detected in Australia and hi art effort to isolate the genes responsible For resistance we have used random amplified DNA fingerprinting (RAF) to produce a genetic linkage map of R. dominica. The map consists of 94 dominant DNA markers with art average distance between markers of 4.6 cM and defines nine linkage groups with a total recombination distance of 390.1 cM. We have identified two loci that are responsible for high-level resistance. One provides similar to50x resistance to phosphine while the other provides 12.5x resistance and in combination, the two genes act synergistically to provide a resistance level 250 x greater than that of fully susceptible beetles. The haploid genome size has been determined to be 4.76 x 10(8) bp, resulting in an average physical distance of 1.2 Mbp per map unit. No recombination has been observed between either of the two resistance loci and their adjacent DNA markers in a population of 44 fully resistant F-5 individuals, which indicates that the genes are likely to reside within 0.91 cM (1.1 Mbp) of the DNA markers.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The I-3 gene from the wild tomato species Lycopersicon pennellii confers resistance to race 3 of the devastating vascular wilt pathogen Fusarium oxysporum f. sp. lycopersici. As an initial step in a positional cloning strategy for the isolation of I-3, we converted restriction fragment length polymorphism and conserved orthologue set markers, known genes and a resistance gene analogue (RGA) mapping to the I-3 region into PCR-based sequence characterised amplified region (SCAR) and cleaved amplified polymorphic sequence (CAPS) markers. Additional PCR-based markers in the I-3 region were generated using the randomly amplified DNA fingerprinting (RAF) technique. SCAR, CAPS and RAF markers were used for high-resolution mapping around the I-3 locus. The I-3 gene was localised to a 0.3-cM region containing a RAF marker, eO6, and an RGA, RGA332. RGA332 was cloned and found to correspond to a putative pseudogene with at least two loss-of-function mutations. The predicted pseudogene belongs to the Toll interleukin-1 receptor-nucleotide-binding site-leucine-rich-repeat sub-class of plant disease resistance genes. Despite the presence of two RGA332 homologues in L. esculentum, DNA gel blot and PCR analysis suggests that no other homologues are present in lines carrying I-3 that could be alternative candidates for the gene.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The ability to generate enormous random libraries of DNA probes via split-and-mix synthesis on solid supports is an important biotechnological application of colloids that has not been fully utilized to date. To discriminate between colloid-based DNA probes each colloidal particle must be 'encoded' so it is distinguishable from all other particles. To this end, we have used novel particle synthesis strategies to produce large numbers of optically encoded particle suitable for DNA library synthesis. Multifluorescent particles with unique and reproducible optical signatures (i.e., fluorescence and light-scattering attributes) suitable for high-throughput flow cytometry have been produced. In the spectroscopic study presented here, we investigated the optical characteristics of multi-fluorescent particles that were synthesized by coating silica 'core' particles with up to six different fluorescent dye shells alternated with non-fluorescent silica 'spacer' shells. It was observed that the diameter of the particles increased by up to 20% as a result of the addition of twelve concentric shells and that there was a significant reduction in fluorescence emission intensities from inner shells as an increasing number of shells were deposited.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Genetic diversity in Cassia brewsteri (F. Muell.) F. Muell. ex Benth. was assessed with Randomly Amplified DNA Fingerprints (RAFs). Thirty accessions of C. brewsteri collected from throughout its natural distribution were analysed with three random decamer primers, along with three accessions of C. tomentella (Benth.) Domin and a single accession of each of C. queenslandica C. T. White and C. marksiana (F. M. Bailey) Domin. The three primers yielded a reproducible amplification profile of 265 scorable polymorphic fragments for the 35 accessions. These molecular markers were used to calculate Nei and Li similarity coefficients between each pair of individuals. A matrix of dissimilarity of each pair of individuals was examined by multidimensional scaling (MDS). The analysis supports the division of C. brewsteri into two subspecies and the suggestion that intergradation of C. brewsteri and C. tomentella can occur where the distributions of these species meet.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

EDD (E3 isolated by differential display), located at chromosome 8q22.3, is the human orthologue of the Drosophila melanogaster tumour suppressor gene 'hyperplastic discs' and encodes a HECT domain E3 ubiquitin protein-ligase. To investigate the possible involvement of EDD in human cancer, several cancers from diverse tissue sites were analysed for allelic gain or loss (allelic imbalance, AI) at the EDD locus using an EDD-specific microsatellite, CEDD, and other polymorphic microsatellites mapped in the vicinity of the 8q22.3 locus. Of 143 cancers studied, 38 had AI at CEDD (42% of 90 informative cases). In 14 of these cases, discrete regions of imbalance encompassing 8q22.3 were present, while the remainder had more extensive 8q aberrations. AI of CEDD was most frequent in ovarian cancer (22/47 informative cases, 47%), particularly in the serous subtype (16/22, 73%), but was rare in benign and borderline ovarian tumours. AI was also common in breast cancer (31%), hepatocellular carcinoma (46%), squamous cell carcinoma of the tongue (50%) and metastatic melanoma (18%). AI is likely to represent amplification of the EDD gene locus rather than loss of heterozygosity, as quantitative RT-PCR and immunohistochemistry showed that EDD mRNA and protein are frequently overexpressed in breast and ovarian cancers, while among breast cancer cell lines EDD overexpression and increased gene copy number were correlated. These results demonstrate that AI at the EDD locus is common in a diversity of carcinomas and that the EDD gene is frequently overexpressed in breast and ovarian cancer, implying a potential role in cancer progression.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Macrophages and B cells are activated by unmethylated CpG-containing sequences in bacterial DNA. The lack of activity of self DNA has generally been attributed to CpG suppression and methylation, although the role of methylation is in doubt. The frequency of CpG in the mouse genome is 12.5% of Escherichia coli, with unmethylated CpG occurring at similar to3% the frequency of E. coli. This suppression of CpG alone is insufficient to explain the inactivity of self DNA; vertebrate DNA was inactive at 100 mug/ml, 3000 times the concentration at which E. coli DNA activity was observed. We sought to resolve why self DNA does not activate macrophages. Known active CpG motifs occurred in the mouse genome at 18% of random occurrence, similar to general CpG suppression. To examine the contribution of methylation, genomic DNAs were PCR amplified. Removal of methylation from the mouse genome revealed activity that was 23-fold lower than E. coli DNA, although there is only a 7-fold lower frequency of known active CpG motifs in the mouse genome. This discrepancy may be explained by G-rich sequences such as GGAGGGG, which potently inhibited activation and are found in greater frequency in the mouse than the E. coli genome. In summary, general CpG suppression, CpG methylation, inhibitory motifs, and saturable DNA uptake combined to explain the inactivity of self DNA. The immunostimulatory activity of DNA is determined by the frequency of unmethylated stimulatory sequences within an individual DNA strand and the ratio of stimulatory to inhibitory sequences.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Six Burkholderia solanacearum (formerly Pseudomonas solanacearum) genomic DNA fragments were isolated, using RAPD techniques and cloning, from the three genetically diverse strains: ACH092 (Biovar 4), ACH0158 (Biovar 2) and ACH0171 (Biovar 3) (1). One of these cloned fragments was selected because it was present constantly in all bacterial strains analysed. The remaining five clones were selected because Southern hybridisation revealed that each showed partial or complete specificity towards the strain of origin. A seventh genomic fragment showing a strain-specific distribution in Southern hybridisations was obtained by differential restriction, hybridisation and cloning of genomic DNA. Each of these clones was sequenced and primers to amplify the insert were designed. When DNA from the strain of origin was used as template, PCR amplification for each of these fragments yielded a single band on gel analysis. One pair of primers amplified the species-constant fragment of 281 bp from DNA of all B. solanacearum strains investigated, from DNA of the closely related bacterium which causes ''blood disease'' of banana (BDB) and in P. syzigii. The sensitivity of detection of B. solanacearum using these ubiquitous primers was between 1.3 and 20 bacterial cells. The feasibility and reliability of a PCR approach to detection and identification of B. solanacearum was tested in diverse strains of the bacterium in several countries and laboratories.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We tested the hypothesis that X-linked genes determining stature which are subject to skewed or non-random X-inactivation can account for discordance in height in monozygotic female twins. Height discordant female monozygotic adult twins (20 pairs) were identified from the Australian Twin Registry, employing the selection criteria of proven monozygosity and a measured height discordance of at least 5 cm. Differential X-inactivation was examined in genomic DNA extracted from peripheral lymphocytes by estimating differential methylation of alleles at the polymorphic CAG triplet repeat of the Androgen receptor gene (XAR). There were 17/20 MZ pairs heterozygous at this locus and informative for analysis. Of these, 10/17 both had random X-inactivation, 5/17 showed identical X-inactivation patterns of non random inactivation and 2/17 (12%) showed discordant X-inactivation. There was no relationship between inactivation patterns and self-report chorionicity. We conclude that non-random X-inactivation does not appear to be a major contributor to intra-pair height discordance in female MZ twins.