51 resultados para Yu gong.


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Subjects with genital warts were immunized three times or more with HPV6b VLPs without adjuvant. All immunized subjects had DTH to HPV6b L1 protein. Of 32 subjects, nine had HPV6b specific antibody prior to immunization and 22 acquired antibody with immunization. VLP specific antibody increased following a single immunization in 6 of 8 subjects with low level antibody at recruitment. Complete regression of genital warts was observed in 25 of 33 evaluable subjects over the 20-week observation period. We conclude that immunization with HPV6b L1 VLPs without adjuvant induces immunity to the L1 protein epitopes recognised during natural infection, and may accelerate regression of warts. (C) 2000 Elsevier Science Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Effect of additives on the starch gelatinization was governed by the processing conditions. The order-disorder transition of starch in water can occur in more than one way and the effect of polar additives on gelatinization can also be in more than one way. The additives appear to be plasticising thermoplastic starches, resulting in improving rheological properties. The thermoplastic starches with the additives are all biodegradable although the rates of biodegradability are slightly different.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The concept of rainfall erosivity is extended to the estimation of catchment sediment yield and its variation over time. Five different formulations of rainfall erosivity indices, using annual, monthly and daily rainfall data, are proposed and tested on two catchments in the humid tropics of Australia. Rainfall erosivity indices, using simple power functions of annual and daily rainfall amounts, were found to be adequate in describing the interannual and seasonal variation of catchment sediment yield. The parameter values of these rainfall erosivity indices for catchment sediment yield are broadly similar to those for rainfall erosivity models in relation to the R-factor in the Universal Soil Loss Equation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background: A variety of methods for prediction of peptide binding to major histocompatibility complex (MHC) have been proposed. These methods are based on binding motifs, binding matrices, hidden Markov models (HMM), or artificial neural networks (ANN). There has been little prior work on the comparative analysis of these methods. Materials and Methods: We performed a comparison of the performance of six methods applied to the prediction of two human MHC class I molecules, including binding matrices and motifs, ANNs, and HMMs. Results: The selection of the optimal prediction method depends on the amount of available data (the number of peptides of known binding affinity to the MHC molecule of interest), the biases in the data set and the intended purpose of the prediction (screening of a single protein versus mass screening). When little or no peptide data are available, binding motifs are the most useful alternative to random guessing or use of a complete overlapping set of peptides for selection of candidate binders. As the number of known peptide binders increases, binding matrices and HMM become more useful predictors. ANN and HMM are the predictive methods of choice for MHC alleles with more than 100 known binding peptides. Conclusion: The ability of bioinformatic methods to reliably predict MHC binding peptides, and thereby potential T-cell epitopes, has major implications for clinical immunology, particularly in the area of vaccine design.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fabrication of heavy-duty printer heads involves a great deal of grinding work. Previously in the printer manufacturing industry, four grinding procedures were manually conducted in four grinding machines, respectively. The productivity of the whole grinding process was low due to the long loading time. Also, the machine floor space occupation was large because of the four separate grinding machines. The manual operation also caused inconsistent quality. This paper reports the system and process development of a highly integrated and automated high-speed grinding system for printer heads. The developed system, which is believed to be the first of its kind, not only produces printer heads of consistently good quality, but also significantly reduces the cycle time and machine floor space occupation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The environmental fate of polycyclic aromatic hydrocarbons (PAHs) in soils is motivated by their wide distribution, high persistence, and potentially deleterious effect on human health. Polycyclic aromatic hydrocarbons constitute the largest group of environmental contaminants released in the environment. Therefore, the potential biodegradation of these compounds is of vital importance. A biocarrier suitable for the colonization by micro-organisms for the purpose of purifying soil contaminated by polycyclic aromatic hydrocarbons was developed. The optimized composition of the biocarrier was polyvinyl alcohol (PVA) 10%, sodium alginate (SA) 0.5%, and powdered activated carbon (PAC) 5%. There was no observable cytotoxicity of biocarriers on immobilized cells and a viable cell population of 1.86 x 10(10) g(-1) was maintained for immobilized bacterium. Biocarriers made from chemical methods had a higher biodegradation but lower mechanical strengths. Immobilized bacterium Zoogloea sp. had an ideal capability of biodegradation for phenanthrene and pyrene over a relative wide concentration range. The study results showed that the biodegradation of phenanthrene and pyrene reached 87.0 and 75.4%, respectively, by using the optimal immobilized method of Zoogloea sp. cultivated in a sterilized soil. Immobilized Zoogloea sp. was found to be effective for biodegrading the soil contaminated with phenanthrene and pyrene. Even in natural (unsterilized) soil, the biodegradation of phenanthrene and pyrene using immobilized Zoogloea sp. reached 85.0 and 67.1%, respectively, after 168 h of cultivation, more than twice that achieved if the cells were not immobilized on the biocarrier. Therefore, the immobilization technology enhanced the competitive ability of introduced micro-organisms and represents an effective method for the biotreatment of soil contaminated with phenanthrene and pyrene.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Understanding the interfacial interactions and structure is important to better design and application of organic-inorganic nanohybrids. This paper presents our recent molecular dynamic studies on organoclays and polymer nanocomposites, including the layering behavior of organoclays, structural and dynamic properties of dioctadecyldimethyl ammoniums in organoclays, and interfacial interactions and structure of polyurethane nanocomposites. The results demonstrate that the layering behaviors of organoclays are closely related to the chain length of quaternary alkyl ammoniums and cation exchangeable capacity of clays. In addition to typical layered structures such as monolayer, bilayer and pseudo-trilayer, a pseudo-quadrilayer structure was also observed in organoclays modified with dioctadecyldimethyl ammoniums (DODDMA). In such a structure, alkyl chains do not lie flat within a single layer but interlace, and also jump to the next layer or even the next nearest layer. Moreover, the diffusion constants of nitrogen and methylene atoms increase with the temperature and methelene towards the tail groups. For polyurethane nanocomposite, the van der Waals interaction between apolar alkyl chains and soft segments of polyurethane predominates the interactions between organoclay and polyurethane. Different from most bulk polyurethane systems, there is no distinct phase-separated structure for the polyurethane.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The identification of genes responsible for the rare cases of familial leukemia may afford insight into the mechanism underlying the more common sporadic occurrences. Here we test a single family with 11 relevant meioses transmitting autosomal dominant acute myelogenous leukemia (AML) and myelodysplasia for linkage to three potential candidate loci. In a different family with inherited AML, linkage to chromosome 21q22.1-22.2 was recently reported; we exclude linkage to 21q22.1-22.2, demonstrating that familial AML is a heterogeneous disease. After reviewing familial leukemia and observing anticipation in the form of a declining age of onset with each generation, we had proposed 9p21-22 and 16q22 as additional candidate loci. Whereas linkage to 9p21-22 can be excluded, the finding of a maximum two-point LOD score of 2.82 with the microsatellite marker D16S522 at a recombination fraction theta = 0 provides evidence supporting linkage to 16q22. Haplotype analysis reveals a 23.5-cM (17.9-Mb) commonly inherited region among all affected family members extending from D16S451 to D1GS289, In order to extract maximum linkage information with missing individuals, incomplete informativeness with individual markers in this interval, and possible deviance from strict autosomal dominant inheritance, we performed nonparametric linkage analysis (NPL) and found a maximum NPL statistic corresponding to a P-value of .00098, close to the maximum conditional probability of linkage expected for a pedigree with this structure. Mutational analysis in this region specifically excludes expansion of the AT-rich minisatellite repeat FRA16B fragile site and the CAG trinucleotide repeat in the E2F-4 transcription factor. The ''repeat expansion detection'' method, capable of detecting dynamic mutation associated with anticipation, more generally excludes large CAG repeat expansion as a cause of leukemia in this family.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This chapter provides an overview of ecotourism in China, including relevant policy, issues, and trends. Most concepts and definitions of ecotourism can be reduced to the following: ecotourism is tourism and recreation that is both nature based and sustainable. The focus of this chapter is on visitation at nature reserves in China. Issues relevant to sustainability and ecotourism objectives are noted in the chapter, and the need for ongoing development of policy and management systems is stressed in order to enhance future achievement of these objectives.