43 resultados para Richards,Equação de
Resumo:
Background, Rural experience for dental students can provide valuable clinical education, change attitudes to rural practice, and make a valuable contribution to clinical service provision. The aim of this paper is to assess the costs and benefits of service delivery by students through rural training programmes Methods: Groups of two students worked in the public dental clinics in adjacent rural centres where there had been long-term difficulties in recruiting staff. The costs and benefits of the programme were assessed by the impact on waiting lists, the total cost per patient of, a course of care and by the marginal cost of adding service provision by students to existing arrangements. Results: The total costs of emergency and complete treatment provided by students were greater than the costs of treatment provided by public-sector dentists but less than the costs of private providers treating public patients. However, the value of services were greater when care was provided by students or private providers and the marginal cost of students providing services was 50-70 per cent of the cost of care provided by public dentists. Conclusion: This assessment suggests that the service benefits achieved compliment the primary objective of influencing the attitude of students to rural practice.
Resumo:
[1] We attempt to generate new solutions for the moisture content form of the one-dimensional Richards' [1931] equation using the Lisle [1992] equivalence mapping. This mapping is used as no more general set of transformations exists for mapping the one-dimensional Richards' equation into itself. Starting from a given solution, the mapping has the potential to generate an infinite number of new solutions for a series of nonlinear diffusivity and hydraulic conductivity functions. We first seek new analytical solutions satisfying Richards' equation subject to a constant flux surface boundary condition for a semi-infinite dry soil, starting with the Burgers model. The first iteration produces an existing solution, while subsequent iterations are shown to endlessly reproduce this same solution. Next, we briefly consider the problem of redistribution in a finite-length soil. In this case, Lisle's equivalence mapping is generalized to account for arbitrary initial conditions. As was the case for infiltration, however, it is found that new analytical solutions are not generated using the equivalence mapping, although existing solutions are recovered.
Resumo:
Light is generally regarded as the most likely cue used by zooplankton to regulate their vertical movements through the water column. However, the way in which light is used by zooplankton as a cue is not well understood. In this paper we present a mathematical model of diel vertical migration which produces vertical distributions of zooplankton that vary in space and time. The model is used to predict the patterns of vertical distribution which result when animals are assumed to adopt one of three commonly proposed mechanisms for vertical swimming. First, we assume zooplankton tend to swim towards a preferred intensity of light. We then assume zooplankton swim in response to either the rate of change in light intensity or the relative rate of change in light intensity. The model predicts that for all three mechanisms movement is fastest at sunset and sunrise and populations are primarily influenced by eddy diffusion at night in the absence of a light stimulus. Daytime patterns of vertical distribution differ between the three mechanisms and the reasons for the predicted differences are discussed. Swimming responses to properties of the light field are shown to be adequate for describing diel vertical migration where animals congregate in near surface waters during the evening and reside at deeper depths during the day. However, the model is unable to explain how some populations halt their ascent before reaching surface waters or how populations re-congregate in surface waters a few hours before sunrise, a phenomenon which is sometimes observed in the held. The model results indicate that other exogenous or endogenous factors besides light may play important roles in regulating vertical movement.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
In this paper we describe the assembly and restriction map of a 1.05-Mb cosmid contig spanning the candidate region for familial Mediterranean fever (FMF), a recessively inherited disorder of inflammation localized to 16p13.3. Using a combination of cosmid walking and screening for P1, PAC, BAG, and YAC clones, we have generated a contig of genomic clones spanning similar to 1050 kb that contains the FMF critical region. The map consists of 179 cosmid, 15 P1, 10 PAC, 3 BAG, and 17 YAC clones, anchored by 27 STS markers. Eight additional STSs have been developed from the similar to 700 kb immediately centromeric to this genomic region. Five of the 35 STSs are microsatellites that have not been previously reported. NotI and EcoRI mapping of the overlapping cosmids, hybridization of restriction fragments from cosmids to one another, and STS analyses have been used to validate the assembly of the contig. Our contig totally subsumes the 250-kb interval recently reported, by founder haplotype analysis, to contain the FMF gene. Thus, our high-resolution clone map provides an ideal resource for transcriptional mapping toward the eventual identification of this disease gene. (C) 1997 Academic Press.
Resumo:
Familial Mediterranean fever (FMF) is a recessively inherited disorder characterized by dramatic episodes of fever and serosal inflammation. This report describes the cloning of the gene likely to cause FMF from a 115-kb candidate interval on chromosome 16p. Three different missense mutations were identified in affected individuals, but not in normals. Haplotype and mutational analyses disclosed ancestral relationships among carrier chromosomes in populations that have been separated for centuries. The novel gene encodes a 3.7-kb transcript that is almost exclusively expressed in granulocytes. The predicted protein, pyrin, is a member of a family of nuclear factors homologous to the Ro52 autoantigen. The cloning of the FMF gene promises to shed light on the regulation of acute inflammatory responses.
Resumo:
Familial Mediterranean fever (FMF) is a recessive disorder of inflammation caused by mutations in a gene (designated MEFV) on chromosome 16p13.3, We have recently constructed a 1-Mb cosmid contig that includes the FMF critical region. Here we show genotype data for 12 markers from our physical map, including 5 newly identified microsatellites, in FMF families. Intrafamilial recombinations placed MEFV in the similar to 285 kb between D16S468/D16S3070 and D16S3376. We observed significant linkage disequilibrium in the North African Jewish population, and historical recombinants in the founder haplotype placed MEFV between D16S3082 and D16S3373 (similar to 200 kb). In smaller panels of Iraqi Jewish, Arab, and Armenian families, there were significant allelic associations only for D16S3370 and D16S2617 among the Armenians. A sizable minority of Iraqi Jewish and Armenian carrier chromosomes appeared to be derived from the North African Jewish ancestral haplotype. We observed a unique FMF haplotype common to Iraqi Jews, Arabs, and Armenians and two other haplotypes restricted to either the Iraqi Jewish or the Armenian population. These data support the view that a few major mutations account for a large percentage of the cases of FMF and suggest that same of these mutations arose before the affected Middle Eastern populations diverged from one another. (C) 1997 Academic Press.
Resumo:
The identification of genes responsible for the rare cases of familial leukemia may afford insight into the mechanism underlying the more common sporadic occurrences. Here we test a single family with 11 relevant meioses transmitting autosomal dominant acute myelogenous leukemia (AML) and myelodysplasia for linkage to three potential candidate loci. In a different family with inherited AML, linkage to chromosome 21q22.1-22.2 was recently reported; we exclude linkage to 21q22.1-22.2, demonstrating that familial AML is a heterogeneous disease. After reviewing familial leukemia and observing anticipation in the form of a declining age of onset with each generation, we had proposed 9p21-22 and 16q22 as additional candidate loci. Whereas linkage to 9p21-22 can be excluded, the finding of a maximum two-point LOD score of 2.82 with the microsatellite marker D16S522 at a recombination fraction theta = 0 provides evidence supporting linkage to 16q22. Haplotype analysis reveals a 23.5-cM (17.9-Mb) commonly inherited region among all affected family members extending from D16S451 to D1GS289, In order to extract maximum linkage information with missing individuals, incomplete informativeness with individual markers in this interval, and possible deviance from strict autosomal dominant inheritance, we performed nonparametric linkage analysis (NPL) and found a maximum NPL statistic corresponding to a P-value of .00098, close to the maximum conditional probability of linkage expected for a pedigree with this structure. Mutational analysis in this region specifically excludes expansion of the AT-rich minisatellite repeat FRA16B fragile site and the CAG trinucleotide repeat in the E2F-4 transcription factor. The ''repeat expansion detection'' method, capable of detecting dynamic mutation associated with anticipation, more generally excludes large CAG repeat expansion as a cause of leukemia in this family.