41 resultados para Rich gaseous fuels


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Carbon monoxide, the chief killer in fires, and other species are modelled for a series of enclosure fires. The conditions emulate building fires where CO is formed in the rich, turbulent, nonpremixed flame and is transported frozen to lean mixtures by the ceiling jet which is cooled by radiation and dilution. Conditional moment closure modelling is used and computational domain minimisation criteria are developed which reduce the computational cost of this method. The predictions give good agreement for CO and other species in the lean, quenched-gas stream, holding promise that this method may provide a practical means of modelling real, three-dimensional fire situations. (c) 2005 The Combustion Institute. Published by Elsevier Inc. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A semi-empirical linear equation has been developed to optimise the amount of maltodextrin additive (DE 6) required to successfully spray dry a sugar-rich product on the basis of its composition. Based on spray drying experiments, drying index values for individual sugars (sucrose, glucose, frutose) and citric acid were determined, and us;ng these index values an equation for model mixtures of these components was established. This equation has been tested with two sugar-rich natural products, pineapple juice and honey. The relationship was found to be valid for these products.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Upper Newlands Seam in the northern Bowen Basin, Queensland, Australia consists of six benches (A-F) that have different petrographic assemblages. Benches C and E contain relatively abundant inertodetrinite and mineral matter, as well as anomalously high reflectance values; these characteristics support a largely allochthonous, detrital origin for the C and E benches. Fractures and cleats in the seam show a consistent orientation of northeast- southwest for face cleats, and a wide range of orientations for fractures. Cleat systems are well developed in bright bands, with poor continuity in the dull coal. Both maceral content and cleat character are suggested to influence gas drainage in the Upper Newlands Seam. A pronounced positive correlation between vitrinite abundance and gas desorption data suggests more efficient drainage from benches with abundant vitrinite. Conversely, inertinite-rich benches are suggested to have less efficient drainage, and possibly retain gas within pore spaces, which could increase the outburst potential of the coal. (C) 2001 Elsevier Science BN. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Leucine-rich repeats (LRRs) are 20-29-residue sequence motifs present in a number of proteins with diverse functions. The primary function of these motifs appears to be to provide a versatile structural framework for the formation of protein-protein interactions. The past two years have seen an explosion of new structural information on proteins with LRRs. The new structures represent different LRR subfamilies and proteins with diverse functions, including GTPase-activating protein rna 1 p from the ribonuclease-inhibitor-like subfamily; spliceosomal protein U2A', Rab geranylgeranyltransferase, internalin B, dynein light chain 1 and nuclear export protein TAP from the SDS22-like subfamily; Skp2 from the cysteine-containing subfamily; and YopM from the bacterial subfamily. The new structural information has increased our understanding of the structural determinants of LRR proteins and our ability to model such proteins with unknown structures, and has shed new light on how these proteins participate in protein-protein interactions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper reports a study in the wet tropics of Queensland on the fate of urea applied to a dairy pasture in the absence of grazing animals. A nitrogen balance was conducted in cylindrical plots with N-15-labelled urea, and ammonia volatilisation was determined using a mass balance micrometeorological method. The pasture plants took up 42% of the applied nitrogen in the 98 days between fertiliser application and harvest. At harvest 18% of the applied nitrogen was found in the soil, and 40% was lost from the plant-soil system. The micrometeorological study showed that 20% of the unrecovered nitrogen was lost by ammonia volatilisation. As there was no evidence for leaching or runoff losses it was concluded that the remaining 20% of the applied nitrogen was lost by denitrification. It is evident from these results that fertiliser nitrogen is not being used efficiently on dairy pastures, and that practices need to be changed to conserve fertiliser nitrogen and reduce contamination of the environment.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Most mammalian cells have in their plasma membrane at least two types of lipid microdomains, non-invaginated lipid rafts and caveolae. Glycosylphosphatidylinositol (GPI)-anchored proteins constitute a class of proteins that are enriched in rafts but not caveolae at steady state. We have analyzed the effects of abolishing GPI biosynthesis on rafts, caveolae, and cholesterol levels. GPI-deficient cells were obtained by screening for resistance to the pore-forming toxin aerolysin, which uses this class of proteins as receptors. Despite the absence of GPI-anchored proteins, mutant cells still contained lipid rafts, indicating that GPI-anchored proteins are not crucial structural elements of these domains. Interestingly, the caveolae-specific membrane proteins, caveolin-1 and 2, were up-regulated in GPI-deficient cells, in contrast to flotillin-I and GM1, which were expressed at normal levels. Additionally, the number of surface caveolae was increased. This effect was specific since recovery of GPI biosynthesis by gene recomplementation restored caveolin expression and the number of surface caveolae to wild type levels. The inverse correlation between the expression of GPI-anchored proteins and caveolin-1 was confirmed by the observation that overexpression of caveolin-1 in wild type cells led to a decrease in the expression of GPI-anchored proteins. In cells lacking caveolae, the absence of GPI-anchored proteins caused an increase in cholesterol levels, suggesting a possible role of GPI-anchored proteins in cholesterol homeostasis, which in some cells, such as Chinese hamster ovary cells, can be compensated by caveolin up-regulation.