63 resultados para Rich, John Treadway, 1841-1926.
Resumo:
We present a photometric investigation of the variation in galaxy colour with environment in 11 X-ray-luminous clusters at 0.07 less than or equal to z less than or equal to 0.16 taken from the Las Campanas/AAT Rich Cluster Survey. We study the properties of the galaxy populations in individual clusters, and take advantage of the homogeneity of the sample to combine the clusters together to investigate weaker trends in the composite sample. We find that modal colours of galaxies lying on the colour-magnitude relation in the clusters become bluer by d(B - R)/dr(p) = -0.022 +/- 0.004 from the cluster core out to a projected radius of r(p) = 6 Mpc, further out in radius than any previous study. We also examine the variation in modal galaxy colour with local galaxy density, 2, for galaxies lying close to the colour-magnitude relation, and find that the median colour shifts bluewards by d(B - R)/d log(10)(Sigma) = -0.076 +/- 0.009 with decreasing local density across three orders of magnitude. We show that the position of the red envelope of galaxies in the colour-magnitude relation does not vary as a function of projected radius or density within the clusters, suggesting that the change in the modal colour results from an increasing fraction of bluer galaxies within the colour-magnitude relation, rather than a change in the colours of the whole population. We show that this shift in the colour-magnitude relations with projected radius and local density is greater than that expected from the changing morphological mix based on the local morphology-density relation. We therefore conclude that we are seeing a real change in the properties of galaxies on the colour-magnitude relation in the outskirts of clusters. The simplest interpretation of this result (and similar constraints in local clusters) is that an increasing fraction of galaxies in the lower density regions at large radii within clusters exhibit signatures of star formation in the recent past, signatures which are not seen in the evolved galaxies in the highest density regions.
Resumo:
In the Leaven of the Ancients, John Walbridge studies the appropriation of non–Peripatetic philosophical ideas by an anti–Aristotelian Islamic philosopher, Shihab al-Din al-Suhrawardi (d. 1191). He proposes a comprehensive explanation of the origin of Suhrawardi's philosophical system, a revival of the “wisdom of the Ancients” and its philosophical affiliations “grounded” in Greek philosophy (p. xiii). Walbridge attempts to uncover the reasons for Suhrawardi's rejection of the prevailing neo–Aristotelian synthesis in Islamic philosophy, Suhrawardi's knowledge and understanding of non–Aristotelian Greek philosophy, the ancient philosophers Suhrawardi was attempting to follow, the relationship between Suhrawardi's specific philosophical teachings (logic, ontology, physics, and metaphysics), and his understanding of non–Aristotelian ancient philosophy and the relationship between Suhrawardi's system and the major Greek philosophers, schools, and traditions—in particular the Presocratics, Plato, and the Stoics (p. 8). Copyright © 2003 Cambridge University Press
Resumo:
Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.
Resumo:
The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.
Resumo:
The use of cell numbers rather than mass to quantify the size of the biotic phase in animal cell cultures causes several problems. First, the cell size varies with growth conditions, thus yields expressed in terms of cell numbers cannot be used in the normal mass balance sense. Second, experience from microbial systems shows that cell number dynamics lag behind biomass dynamics. This work demonstrates that this lag phenomenon also occurs in animal cell culture. Both the lag phenomenon and the variation in cell size are explained using a simple model of the cell cycle. The basis for the model is that onset of DNA synthesis requires accumulation of G1 cyclins to a prescribed level. This requirement is translated into a requirement for a cell to reach a critical size before commencement of DNA synthesis. A slower gl-owing cell will spend more time in G1 before reaching the critical mass. In contrast, the period between onset of DNA synthesis and mitosis, tau(B), is fixed. The two parameters in the model, the critical size and tau(B), were determined from eight steady-state measurements of mean cell size in a continuous hybridoma culture. Using these parameters, it was possible to predict with reasonable accuracy the transient behavior in a separate shift-up culture, i.e., a culture where cells were transferred from a lean environment to a rich environment. The implications for analyzing experimental data for animal cell culture are discussed. (C) 1997 John Wiley & Sons, Inc.
Resumo:
A semi-empirical linear equation has been developed to optimise the amount of maltodextrin additive (DE 6) required to successfully spray dry a sugar-rich product on the basis of its composition. Based on spray drying experiments, drying index values for individual sugars (sucrose, glucose, frutose) and citric acid were determined, and us;ng these index values an equation for model mixtures of these components was established. This equation has been tested with two sugar-rich natural products, pineapple juice and honey. The relationship was found to be valid for these products.