Geospatial clustering in data-rich environments: Features and issues

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

Searching behaviour and diet of Oystercatcher Haematopus ostralegus pairs feeding in their territories

Search path, searching behaviour and diet of pairs of Oystercatchers feeding in mudflat territories were studied during spring. females ate Nereis, Mya, small unidentified prey, probably Corophium, and a few Macoma, whereas males primarily ate Macoma. Even when female and male foraged in the same site, they often caught different prey. The combination of 'The Search-rate/Detection Model' (Gendron & Staddon 1983) and 'The Harvestable Prey Model' (Zwarts & Wanink 1993) provide the theoretical framework in which to explain these differences in diet. Macoma are thought to be more cryptic than Nereis, Mya and Corophium. Therefore females, while searching at a faster rate than their respective mates, caught far fewer cryptic prey, but a greater number of more conspicuous prey than their mates. On the basis of distances moved before and after capturing prey, males exhibited area-restricted searching for Macoma and Corophium. In contrast, females did not exhibit any area-restricted searching. it is suggested that the distribution of Macoma and Corophium available to males searching slowly was more clumped than that of these two prey species available to females searching more quickly.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Problems associated with spray drying of sugar-rich foods

Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.

The myosin-I-binding protein Acan125 binds the SH3 domain and belongs to the superfamily of leucine-rich repeat proteins

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.

Whose diet has changed?

The same questions about diet were asked in two community-based surveys conducted in the Hunter Region of New South Wales in 1983 and 1994. There were substantial changes in diet over the period; for example, the proportion of respondents who reported using low-fat or skim milk increased from 25 per cent to 51 per cent, the proportion eating meat fewer than five times a week doubled from 21 per cent to 42 per cent and the proportion eating fewer than three eggs per week increased from 55 per cent to 80 per cent. In both surveys, women reported eating a healthier diet than men, and older people and those of higher socioeconomic status reported better diets than younger people or people with less education or lower status occupations. The surprising finding was that over the 11-year period the changes in patterns of food consumption were remarkably similar across all strata of the population. The conclusions are that wide-spread dietary change is possible. However, the changes in the last decade related mainly to reducing the risk of cardiovascular disease; similar behavioural changes to reduce the risk of diet-related cancer are required.

A semi-empirical approach to optimise the quantity of drying aids required to spray dry sugar-rich foods

A semi-empirical linear equation has been developed to optimise the amount of maltodextrin additive (DE 6) required to successfully spray dry a sugar-rich product on the basis of its composition. Based on spray drying experiments, drying index values for individual sugars (sucrose, glucose, frutose) and citric acid were determined, and us;ng these index values an equation for model mixtures of these components was established. This equation has been tested with two sugar-rich natural products, pineapple juice and honey. The relationship was found to be valid for these products.