Calcium is essential for the structural integrity of the cysteine-rich, ligand-binding repeat of the low-density lipoprotein receptor

Seven cysteine-rich repeats form the ligand-binding region of the low-density lipoprotein (LDL) receptor. Each of these repeats is assumed to bind a calcium ion, which is needed for association of the receptor with its ligands, LDL and beta-VLDL. The effects of metal ions on the folding of the reduced N-terminal cysteine-rich repeat have been examined by using reverse-phase high-performance liquid chromatography to follow the formation of fully oxidized isomers with different disulfide connectivities. in the absence of calcium many of the 15 possible isomers formed on oxidation, whereas in its presence the predominant product at equilibrium had the native disulfide bond connectivities. Other metals were far less effective at directing disulfide bond formation: Mn2+ partly mimicked the action of Ca2+, but Ba2+, Sr2+, and Mg2+ had little effect. This metal-ion specificity was also observed in two-dimensional H-1 NMR spectral studies: only Ca2+ induced the native three-dimensional fold. The two paramagnetic ions, Gd3+ and Mn2+, and Cd2+ did not promote adoption of a well-defined structure, and the two paramagnetic ions did not displace calcium ions. The location of calcium ion binding sites in the repeat was also explored by NMR spectroscopy. The absence of chemical shift changes for the side chain proton resonances of Asp26, Asp36, and Glu37 from pH 3.9 to 6.8 in the presence of calcium ions and their proximal location in the NMR structures implicated these side chains as calcium ligands. Deuterium exchange NMR experiments also revealed a network of hydrogen bonds that stabilizes the putative calcium-binding loop.

Inhibition of phenotype modulation, growth, and migration of vascular smooth muscle cells by a guanosine-rich 30-mer phosphorothioate oligodeoxynucleotide

The testing of a 30-mer dG-rich phosphorothioate oligodeoxynucleotide (LG4PS) for effects on the behaviour of vascular smooth muscle cells (VSMC) in vitro and in vivo is described. LG4PS at 0.3 mu M inhibited significantly the phenotype modulation of freshly isolated rabbit VSMC, and cell outgrowth from pig aortic explants was inhibited similar to 80% by 5 mu M LG4PS. The growth of proliferating rabbit and pig VSMC was inhibited similar to 70% by 0.3 mu M and 5 mu M LG4PS, respectively. Though less marked, the antiproliferative effects of LG4PS on human VSMC were comparable to those obtained with heparin. The cytotoxic effects of LG4PS on VSMC in vitro were low. Despite these promising results, adventitial application of 2-200 nmol LG4PS in pluronic gel failed to reduce vascular hyperplasia in balloon-injured rabbit carotid arteries, and the highest dose caused extensive mortality. (C) 1997 Academic Press Limited.

Emergence of multidrug-resistant tuberculosis in a community-based directly observed treatment programme in rural South Africa

OBJECTIVE: Although little studied in developing countries, multidrug-resistant tuberculosis (MDR-TB) is considered a major threat. We report the molecular epidemiology, clinical features and outcome of an emerging MDR-TB epidemic. METHODS: In 1996 all tuberculosis suspects in the rural Hlabisa district, South Africa, had sputum cultured, and drug susceptibility patterns of mycobacterial isolates were determined. Isolates with MDR-TB (resistant to both isoniazid and rifampicin) were DNA fingerprinted by restriction fragment length polymorphism (RFLP) using IS6110 and polymorphic guanine-cytosine-rich sequence-based (PGRS) probes. Patients with MDR-TB were traced to determine outcome. Data were compared with results from a survey of drug susceptibility done in 1994. RESULTS: The rate of MDR-TB among smear-positive patients increased six-fold from 0.36% (1/275) in 1994 to 2.3% (13/561) in 1996 (P = 0.04). A further eight smear-negative cases were identified in 1996 from culture, six of whom had not been diagnosed with tuberculosis. MDR disease was clinically suspected in only five of the 21 cases (24%). Prevalence of primary and acquired MDR-TB was 1.8% and 4.1%, respectively. Twelve MDR-TB cases (67%) were in five RFLP-defined clusters. Among 20 traced patients, 10 (50%) had died, five had active disease (25%) and five (25%) were apparently cured. CONCLUSIONS: The rate of MDR-TB has risen rapidly in Hlabisa, apparently due to both reactivation disease and recent transmission. Many patients were not diagnosed with tuberculosis and many were not suspected of drug-resistant disease, and outcome was poor.

Applications of NMR in drug design: Sructure-activity relationships in disulfide-rich peptides

NMR is a powerful technique for determining structures of biologically active molecules in solution. In recent years. our laboratory has focussed on the structure determination of small disulfide-rich proteins from both plants and animals which are valuable targets in drug design applications. This article will review these structural studies and their implications in drug design.

Compact stellar systems in the Fornax Cluster: Super-massive star clusters or extremely compact dwarf galaxies?

We describe a population of compact objects in the centre of the Fornax Cluster which were discovered as part of our 2dF Fornax Spectroscopic Survey. These objects have spectra typical of old stellar systems, but are unresolved on photographic sky survey plates. They have absolute magnitudes - 13 < M-B

Geospatial clustering in data-rich environments: Features and issues

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Problems associated with spray drying of sugar-rich foods

Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.

The myosin-I-binding protein Acan125 binds the SH3 domain and belongs to the superfamily of leucine-rich repeat proteins

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.

A semi-empirical approach to optimise the quantity of drying aids required to spray dry sugar-rich foods

A semi-empirical linear equation has been developed to optimise the amount of maltodextrin additive (DE 6) required to successfully spray dry a sugar-rich product on the basis of its composition. Based on spray drying experiments, drying index values for individual sugars (sucrose, glucose, frutose) and citric acid were determined, and us;ng these index values an equation for model mixtures of these components was established. This equation has been tested with two sugar-rich natural products, pineapple juice and honey. The relationship was found to be valid for these products.