Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Application of inter simple sequence repeat (ISSR) markers to plant genetics

Microsatellites or simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Single-locus SSR markers have been developed for a number of species, although there is a major bottleneck in developing SSR markers whereby flanking sequences must be known to design 5'-anchors for polymerase chain reaction (PCR) primers. Inter SSR (ISSR) fingerprinting was developed such that no sequence knowledge was required. Primers based on a repeat sequence, such as (CA)(n), can be made with a degenerate 3'-anchor, such as (CA)(8)RG or (AGC)(6)TY. The resultant PCR reaction amplifies the sequence between two SSRs, yielding a multilocus marker system useful for fingerprinting, diversity analysis and genome mapping. PCR products are radiolabelled with P-32 or P-33 via end-labelling or PCR incorporation, and separated on a polyacrylamide sequencing gel prior to autoradiographic visualisation. A typical reaction yields 20-100 bands per lane depending on the species and primer. We have used ISSR fingerprinting in a number of plant species, and report here some results on two important tropical species, sorghum and banana. Previous investigators have demonstrated that ISSR analysis usually detects a higher level of polymorphism than that detected with restriction fragment length polymorphism (RFLP) or random amplified polymorphic DNA (RAPD) analyses. Our data indicate that this is not a result of greater polymorphism genetically, but rather technical reasons related to the detection methodology used for ISSR analysis.

Transgendering shojo shosetsu: Girls' inter-text/sex-uality

This essay recognises the power of reading and intertextuality (embedding texts within texts) in fiction targeted at girls and young women.

RNA trafficking signals in human immunodeficiency virus type 1

Intracellular trafficking of retroviral RNAs is a potential mechanism to target viral gene expression to specific regions of infected cells. Here we show that the human immunodeficiency virus type 1 (HIV-1) genome contains two sequences similar to the hnRNP A2 response element (A2RE), a cis-acting RNA trafficking sequence that binds to the trans-acting trafficking factor, hnRNP A2, and mediates a specific RNA trafficking pathway characterized extensively in oligodendrocytes. The two HIV-1 sequences, designated A2RE-1, within the major homology region of the gag gene, and A2RE-2, in a region of overlap between the vpr and tat genes, both bind to hnRNP A2 in vitro and are necessary and sufficient for RNA transport in oligodendrocytes in vivo. A single base change (A8G) in either sequence reduces hnRNP A2 binding and, in the case of A2RE-2, inhibits RNA transport. A2RE-mediated RNA transport is microtubule and hnRNP A2 dependent. Differentially labelled gag and vpr RNAs, containing A2RE-1 and A2RE-2, respectively, coassemble into the same RNA trafficking granules and are cotransported to the periphery of the cell. tat RNA, although it contains A2RE-2, is not transported as efficiently as vpr RNA. An A2RE/hnRNP A2-mediated trafficking pathway for HIV RNA is proposed, and the role of RNA trafficking in targeting HIV gene expression is discussed.

A for stage III and IV squamous carcinoma of the head and neck: a Trans-Tasman Radiation Oncology Group Study

Purpose: The aims of this randomized controlled trial were to determine whether there were differences in the disease-free survival (DFS) and toxicity between conventional radiotherapy (CRT) and a continuous 3 week accelerated radiotherapy regimen (ART) in stage III and IV squamous cell carcinoma of the oral cavity, oropharynx, larynx and hypopharynx. Patients and methods: Patients from 14 centres throughout Australia and New Zealand were randomly assigned to either CRT, using a single 2 Gy/day to a dose of 70 Gy in 35 fractions in 49 days or to ART, using 1.8 Gy twice a day to a dose of 59.4 Gy in 33 fractions in 24 days. Treatment allocation was stratified for site and stage. The accrual began in 1991 and the trial was closed in 1998 when the target of 350 patients was reached. Results: The median potential follow-up time was 53 months (range, 14-101). The DFS at 5 years was 41% (95% CI, 33-50%) for ART and 35% (95% CI, 27-43%) for CRT (P = 0.323) and the hazard ratio was 0.87 in favour of ART (95% CI, 0.66-1.15). The 5-year disease-specific survival rates were 40% for CRT and 46% for ART (P = 0.398) and the loco-regional control was 47% for CRT vs. 52% for ART (P = 0.300). The respective hazard ratios were 0.88 (95% CI, 0.65-1.2) and 0.85 (0.62-1.16), favouring the accelerated arm. In the ART arm, confluent mucositis was more severe (94 vs. 71%; P < 0.001) and peaked about 3 weeks earlier than in the CRT arm, but healing appeared complete in all cases. There were statistically significant reductions in the probability of grade 2 or greater late soft tissue effects over time in the ART arm (P < 0.05), except for the mucous membrane where late effects were similar in both arms. Conclusions: Differences in DFS, disease-specific survival and loco-regional control have not been demonstrated. ART resulted in more acute mucosal toxicity, but this did not result in greater prolongation of the treatment time compared with the CRT arm. There were less late effects in the ART arm, with the exception of late mucosal effects. This trial has confirmed that tumour cell repopulation occurs during conventionally fractionated radiotherapy for head and neck cancer. However, it has also provided additional evidence that overall improvements in the therapeutic ratio using accelerated fractionation strategies are seriously constrained by the need to limit total doses to levels that do not exceed acute mucosal tolerance. The accelerated schedule tested has been shown in this trial to be an acceptable alternative to conventionally fractionated irradiation to 70 Gy. (C) 2001 Elsevier Science Ireland Ltd. All rights reserved.

Gag-Pol supplied in trans is efficiently packaged and supports viral function in human immunodeficiency virus type 1

The intracellular trafficking and subsequent incorporation of Gag-Pol into human immunodeficiency virus type 1 (HIV-1) remains poorly defined. Gag-Pol is encoded by the same mRNA as Gag and is generated by ribosomal frameshifting. The multimerization of Gag and Gag-Pol is an essential step in the formation of infectious viral particles. In this study, we examined whether the interaction between Gag and Gag-Pol is initiated during protein translation in order to facilitate the trafficking and subsequent packaging of Gag-Pol into the virion. A conditional cotransfection system was developed in which virion formation required the coexpression of two HIV-1-based plasmids, one that produces both Gag and Gag-Pol and one that only produces Gag-Pol. The Gag-Pol proteins were either immunotagged with a His epitope or functionally tagged with a mutation (K65R) in reverse transcriptase that is associated with drug resistance. Gag-Pol packaging was assessed to determine whether the Gag-Pol incorporated into the virion was preferentially packaged from the plasmid that expressed both Gag and Gag-Pol or whether it could be packaged from either plasmid. Our data show that translation of Gag and Gag-Pol from the same mRNA is not critical for virion packaging of the Gag-Pol polyprotein or for viral function.

The GRIP domain is a specific targeting sequence for a population of trans-Golgi network derived tubulo-vesicular carriers

Vesicular carriers for intracellular transport associate with unique sets of accessory molecules that dictate budding and docking on specific membrane domains. Although many of these accessory molecules are peripheral membrane proteins, in most cases the targeting sequences responsible for their membrane recruitment have yet to be identified. We have previously defined a novel Golgi targeting domain (GRIP) shared by a family of coiled-coil peripheral membrane Golgi proteins implicated in membrane trafficking. We show here that the docking site for the GRIP motif of p230 is a specific domain of Golgi. membranes. By immunoelectron microscopy of HeLa cells stably expressing a green fluorescent protein (GFP)-p230(GRIP) fusion protein, we show binding specifically to a subset of membranes of the trans-Golgi network (TGN). Real-time imaging of live HeLa cells revealed that the GFP-p230(GRIP) was associated with highly dynamic tubular extensions of the TGN, which have the appearance and behaviour of transport carriers. To further define the nature of the GRIP membrane binding site, in vitro budding assays were performed using purified rat liver Golgi membranes and cytosol from GFP-p230(GRIP) transfected cells. Analysis of Golgi-derived vesicles by sucrose gradient fractionation demonstrated that GFP-p230(GRIP) binds to a specific population of vesicles distinct from those labelled for beta -COP or gamma -adaptin. The GFP-p230(GRIP) fusion protein is recruited to the same vesicle population as full-length p230, demonstrating that the GRIP domain is solely proficient as a targeting signal for membrane binding of the native molecule. Therefore, p230 GRIP is a targeting signal for recruitment to a highly selective membrane attachment site on a specific population of trans-Golgi network tubulovesicular carriers.

Early toxicity from preoperative radiotherapy with continuous infusion 5-fluorouracil for resectable adenocarcinoma of the rectum: A phase II trial for the Trans-Tasman Radiation Oncology Group

Purpose: To assess the toxicity and the efficacy of preoperative radiotherapy with continuous infusion 5-fluorouracil (5-FU) for locally advanced adenocarcinoma of the rectum. Methods and Materials: Eligible patients had newly diagnosed localized adenocarcinoma of the rectum within 12 cm of the anal verge, Stage T3-4, and were suitable for curative resection. Eighty-two patients were treated with radiotherapy-50.4 Gy in 28 fractions in 5.6 weeks, given concurrently with continuous infusion 5-FU, using either 96-h/week infusion at 300 mg/m(2)/day or 7-days/week infusion at 225 mg/m(2)/day. Results: The median age was 59 years (range, 27-87), and 67% of patients were male. Pretreatment stages of the rectal cancer were T3, 89% and resectable T4, 11%, with endorectal ultrasound confirmation in 67% of patients. Grade 3 acute toxicity occurred in 5 of 82 patients (6%; 95% confidence interval [CI], 2-14%). Types of surgical resection were anterior resection, 61%; abdominoperineal resection, 35%; and other procedures, 4%. There was no operative mortality. Anastomotic leakage after low anterior resection occurred in 3 of 50 patients (6%; 95% CI, 1-17%). The pathologic complete response rate was 16% (95% CI, 9-26%). Pathologic Stages T2 or less occurred in 51%. Conclusion: Preoperative radiotherapy with continuous infusion 5-FU for locally advanced rectal cancer is a safe regimen, with a significant downstaging effect. It does not seem to lead to a significant increase in serious surgical complications. (C) 2001 Elsevier Science Inc.

Acute symptoms, not rectally administered sucralfate, predict for late radiation proctitis: Longer term follow-up of a phase III trial - trans-Tasman radiation oncology group

Image : To assess the potential for sucralfate administered rectally to reduce the risk of late rectal morbidity in patients undergoing nonconformal radiotherapy (RT) for carcinoma of the prostate and to study the variables potentially contributing to late rectal morbidity and particularly to explore the relationship between acute and late toxicity. Image : Eighty-six patients with localized prostate carcinoma were randomized in a double-blind, placebo-controlled study to a daily enema of 3 g of sucralfate in a 15-mL suspension or the same suspension without sucralfate. The enema began the first day of RT and was continued for 2 weeks after treatment completion. The primary end point of the study was acute Radiation Therapy Oncology Group (RTOG)/European Organization for Research and Treatment of Cancer (EORTC) toxicity; however, the patients were followed for an additional 5 years on a 6-month basis. The evaluation included late RTOG/EORTC toxicity and a patient self-assessment questionnaire. Image : With a median follow-up of 5 years, the Kaplan-Meier probability of late Grade 2 RTOG/EORTC toxicity was 12% (95% confidence interval [CI] 2–22%) for placebo and 5% (95% CI 0–12%) for sucralfate (p = 0.26). The probability of late rectal bleeding was 59% (95% CI 45–73%) for placebo and 54% (95% CI 40–68%) for sucralfate. No statistically significant difference was found between the treatment arms for the peak incidence of any of the other patient self-assessment variables. Cox proportional hazards modeling indicated acute RTOG/EORTC toxicity of Grade 2 or greater was associated with a hazard ratio of 2.74 (95% CI 1.31–5.73) for the development of late toxicity of Grade 1 or greater. Substituting the patient self-assessment variables for acute RTOG/EORTC toxicity revealed that rectal pain of a moderate or severe grade during RT was the best predictor of the subsequent development of late toxicity, with a hazard ratio of 3.44 (95% CI 1.68–7). Image : The results of this study do not support the use of sucralfate administered rectally as a method for reducing the late toxicity of nonconformal RT for prostate cancer. There appears to be an association between the development of acute and subsequent late toxicity, although the nature of this association remains to be determined