45 resultados para Hobson, Allan J.: Unennäöstä. Johdatus unitutkimukseen
Resumo:
Accepting Furet’s claim that events acquire meaning and significance only in the context of narratives, this article argues that a particular type of international relations narrative has emerged with greater distinction after the traumatic experience of September 11: the gothic narrative. In a sense the political rhetoric of President Bush marks the latest example of America’s fine tradition in the gothic genre that began with Edgar Allan Poe and Nathaniel Hawthorne and extends through Henry James to Stephen King. His discourse of national security, it will be shown, assumes many of the predicates of gothic narratives. The gothic scenes evoked by Bush as much as Poe involve monsters and ghosts in tenebrous atmospheres that generate fear and anxiety, where terror is a pervasive tormentor of the senses. Poe’s narratives, for example, turn on encounters with dark, perverse, seemingly indomitable, forces often entombed in haunted houses. Similarly, Bush’s post-September 11 narratives play upon fears of terrorists and rogue states who are equally dark, perverse and indomitable forces. In both cases, ineffable and potently violent and cruel forces haunt and terrorise the civilised, human world.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
To determine which genes of the plasminogen activator (PA) system were expressed in osteoclasts, RNA extracted from microisolated mouse osteoclasts was used as template for reverse transcribed polymerase chain reaction (RT-PCR) with gene-specific primer pairs, Using this approach, the expression of RNAs for tissue-type plasminogen activator, urokinase-type plasminogen activator, plasminogen activator inhibitor-1, plasminogen activator inhibitor-2, protease nexin, and urokinase receptor isoform 1 (uPAR1) were detected in mouse osteoclasts. The expression of uPAR RNA in osteoclasts was confirmed by in situ hybridization with a uPAR1 probe, RNA encoding the uPAR isoform 2 was not detected in mouse osteoclasts, but a novel unspliced uPAR RNA variant was detected in these cells, The novel uPAR variant and uPAR1 RNA were also detected in mouse calvarial osteoblasts, kidney, muscle, and the mouse macrophage cell line J774A.1 by RT-PCR The presence of RNAs for most of the components of the PA system in osteoclasts suggests that it may have a functional role in this cell type.
Resumo:
The identification of genes responsible for the rare cases of familial leukemia may afford insight into the mechanism underlying the more common sporadic occurrences. Here we test a single family with 11 relevant meioses transmitting autosomal dominant acute myelogenous leukemia (AML) and myelodysplasia for linkage to three potential candidate loci. In a different family with inherited AML, linkage to chromosome 21q22.1-22.2 was recently reported; we exclude linkage to 21q22.1-22.2, demonstrating that familial AML is a heterogeneous disease. After reviewing familial leukemia and observing anticipation in the form of a declining age of onset with each generation, we had proposed 9p21-22 and 16q22 as additional candidate loci. Whereas linkage to 9p21-22 can be excluded, the finding of a maximum two-point LOD score of 2.82 with the microsatellite marker D16S522 at a recombination fraction theta = 0 provides evidence supporting linkage to 16q22. Haplotype analysis reveals a 23.5-cM (17.9-Mb) commonly inherited region among all affected family members extending from D16S451 to D1GS289, In order to extract maximum linkage information with missing individuals, incomplete informativeness with individual markers in this interval, and possible deviance from strict autosomal dominant inheritance, we performed nonparametric linkage analysis (NPL) and found a maximum NPL statistic corresponding to a P-value of .00098, close to the maximum conditional probability of linkage expected for a pedigree with this structure. Mutational analysis in this region specifically excludes expansion of the AT-rich minisatellite repeat FRA16B fragile site and the CAG trinucleotide repeat in the E2F-4 transcription factor. The ''repeat expansion detection'' method, capable of detecting dynamic mutation associated with anticipation, more generally excludes large CAG repeat expansion as a cause of leukemia in this family.
Resumo:
The report was commissioned by the Department of Education, Science and Training to investigate the perceived efficacy of middle years programmes in all States and Territories in improving the quality of teaching, learning and student outcomes, especially in literacy and numeracy and for student members of particular target groups. These target groups included students from lower socio-economic communities, Aboriginal and Torres Strait Islander communities, students with a language background other than English, rural and remote students, and students struggling with the transition from middle/upper primary to the junior secondary years. The project involved large scale national and international literature reviews on Australian and international middle years approaches as well as an analysis of key literacy and numeracy teaching and learning strategies being used. In the report, there is emergent evidence of the relative efficacy of a combination of explicit state policy, dedicated funding and curriculum and professional development frameworks that are focused on the improvement of classroom pedagogy in the middle years. The programs that evidenced the greatest current and potential value for target group students tended to have developed in state policy environments that encouraged a structural rather than adjunct approach to middle years innovations. The authors conclude that in order to translate the gains made into sustainable improvement of educational results in literacy and numeracy for target groups, there is a need for a second generation of middle years theorising, research, development and practice.
Resumo:
This research project was commissioned by the Commonwealth Department of Education, Science and Training to investigate the perceived efficacy of middle years programs in all States and Territories in improving the quality of teaching, learning and student outcomes - especially in literacy and numeracy and for student members of particular target groups. The latter groups included students from lower socio-economic communities, Aboriginal and Torres Strait Islander (Indigenous) communities, students with a Language Background Other than English (hereafter LBOTE), rural and remote students, and students struggling with the transition from middle/upper primary to the junior secondary years.
Resumo:
p73 has recently been identified as a structural and functional homolog of the tumor suppressor protein p53. Overexpression of p53 activates transcription of p53 effector genes, causes growth inhibition and induced apoptosis. We describe here the effects of a tumor-derived truncated transcript of p73 alpha (p73 Delta exon2) on p53 function and on cell death. This transcript, which lacks the acidic N-terminus corresponding to the transactivation domain of p53, was initially detected in a neuroblastoma cell line. Overexpression of p73 Delta exon2 partially protects lymphoblastoid cells against apoptosis induced by anti-Fas antibody or cisplatin. By cotransfecting p73 Delta exon2 with wild-type p53 in the p53 null line Saos 2, we found that this truncated transcript reduces the ability of wild-type p53 to promote apoptosis. This anti-apoptotic effect was also observed when p73 Delta exon2 was co-transfected with full-length p73 (p73 alpha). This was further substantiated by suppression of p53 transactivation of the effector gene p21-Waf1 in p73 Delta exon2 transfected cells and by inhibition of expression of a reporter gene under the control of the p53 promoter. Thus, this truncated form of p73 can act as a dominant-negative agent towards transactivation by p53 and p73 alpha, highlighting the potential implications of these findings for p53 signaling pathway. Furthermore, we demonstrate the existence of a p73 Delta exon2 transcript in a very significant proportion (46%) of breast cancer cell lines. However, a large spectrum of normal and malignant tissues need to be surveyed to determine whether this transdominant p73 variant occurs in a tumor-specific manner.