44 resultados para Heer, P. O. C. Vorsselman de.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Report of a submission being made to a major international software engineering standards group, the Object Management Group which ties together OMG standards with World-Wide Web Consortium and International Standards Organization standards. Major industry bodies including IBM are collaborating, and the submission has the support of 24 companies. OMG, W3C and ISO standards strongly influence the industry, especially in combination. Colomb was a major contributor, responsible for 30% of the submission, and the primary author of the paper.
Resumo:
A k-star is the graph K-1,K-k. We prove a general theorem about k-star factorizations of Cayley graphs. This is used to give necessary and sufficient conditions for the existence of k-star factorizations of any power (K-q)(S) of a complete graph with prime power order q, products C-r1 x C-r2 x ... x C-rk of k cycles of arbitrary lengths, and any power (C-r)(S) of a cycle of arbitrary length. (C) 2001 John Wiley & Sons, Inc.
Resumo:
For products sold with warranty, preventive maintenance actions by manufacturers and/or buyers have an impact on the total costs for both parties. This paper develops a framework to study preventive maintenance actions when items are sold under warranty and reviews the models that have appeared in the literature. It then develops a new model and carries out its analysis.
Resumo:
In this paper theoretical models have been established that can account for the gas transmission through nanocomposite laminates, consisting of an oxide layer of finite permeability containing defects, on a polymer sheet of finite thickness. The defect shapes can either be in the form of long cracks or rectangular holes. The models offer a choice of exact numerical calculations or fast and intuitive analytical approximations. The experimental measurements of oxygen permeation through four different SiOx/poly (ethylene terephthalate) samples that were strained to produce distributions or cracks showed good agreement when compared with predicted results from the approximate analytic model. As a consequence of this observation, a key practical conclusion is that, because of the logarithmic dependence of transmission on the width of a crack, for a given strain it is better to have a small number of large cracks rather than a large number of small cracks. (C) 2001 Elsevier Science B.V. All rights reserved.