Purification and characterization of a plant antimicrobial peptide expressed in Escherichia coli

MiAMP1 is a low-molecular-weight, cysteine-rich, antimicrobial peptide isolated from the nut kernel of Macadamia integrifolia. A DNA sequence encoding MiAMP1 with an additional ATG: start codon was cloned into a modified pET vector under the control of the T7 RNA polymerase promoter. The pET vector was cotransformed together with the vector pSB161, which expresses a rare arginine tRNA. The peptide was readily isolated in high yield from the insoluble fraction of the Escherichia coil extract. The purified peptide was shown to have an identical molecular weight to the native peptide by mass spectroscopy indicating that the N-terminal methionine had been cleaved. Analysis by NMR spectroscopy indicated that the refolded recombinant peptide had a similar overall three-dimensional structure to that of the native peptide. The peptide inhibited the growth of phytopathogenic fungi in vitro in a similar manner to the native peptide. To our knowledge, MiAMP1 is the first antimicrobial peptide from plants to be functionally expressed in E. coil. This will permit a detailed structure-function analysis of the peptide and studies of its mode of action on phytopathogens. (C) 1999 Academic Press.

Identification in Australia of the quarantine pathogen of sunflower Phoma macdonaldii (Teleomorph : Leptosphaeria lindquistii)

Isolations from black stem lesions of sunflower growing in south-eastern Queensland yielded fungi putatively identified as species of Phoma. Pathogenicity assays showed that these isolates were capable of killing sunflower plants under glasshouse conditions. The isolates were compared with authentic cultures of Phoma macdonaldii and other isolates of Phoma taken from sunflower from around the world. Random amplified polymorphic DNA analysis showed that all the Australian isolates examined were very similar to the holotype culture of Phoma macdonaldii from Canada. Sequencing of the internal transcribed spacer regions also revealed the relatedness of the Australian isolates to the holotype. This is the first official record of P. macdonaldii in Australia.

The novel mitochondrial gene arrangement of the cattle tick, Boophilus microplus: Fivefold tandem repetition of a coding region

We sequenced across all of the gene boundaries in the mitochondrial genome of the cattle tick, Boophilus microplus, to determine the arrangement of its genes. The mtDNA of B. microplus has a coding region, composed of tRNA(Glu) and 60 bp of the 3' end of ND1, that is repeated five times. Boophilus microplus is the first coelomate animal known to have more than two copies of a coding sequence. The mitochondrial genome of B, microplus has other unusual features, including (1) reduced T arms in tRNAs, (2) an AT bias in codon use, (3) two control regions that have evolved in concert, (4) three gene rearrangements, and (5) a stem-loop between tRNA(Gln) and tRNA(Phe). The short T arms and small control regions (CRs) of B. microplus and other ticks suggest strong selection for small genomes. Imprecise termination of replication beyond its origin, which can account for the evolution of tandem repeats of coding regions in other mitochondrial genomes, cannot explain the evolution of the fivefold repeated sequence in the mitochondrial genome of B. microplus. Instead, slipped-strand mispairing or recombination are the most plausible explanations for the evolution of these tandem repeats.

Cytomegalovirus evasion of natural killer cell responses

Natural killer (NK) cells are an important component of the innate cellular immune system. They are particularly important during the early immune responses following virus infection, prior to the induction of cytotoxic T cells (CTL). Unlike CTL, which recognize specific peptides displayed on the surface of cells by class I MHC, NK cells respond to aberrant expression of cell surface molecules, in particular class I MHC, in a non-specific manner. Thus, cells expressing low levels of surface class I MHC are susceptible to recognition by NK cells, with concomitant triggering of cytolytic and cytokine-mediated responses. Many viruses, including the cytomegaloviruses, downregulate cell surface MHC class I: this is likely to provide protection against CTL-mediated clearance of infected cells, but may also render infected cells sensitive to NK-cell attack. This review focuses upon cytomegalovirus-encoded proteins that are believed to promote evasion of NK-cell-mediated immunity. The class I MHC homologues, encoded by all cytomegaloviruses characterised to date, have been implicated as molecular 'decoys', which may mimic the ability of cellular MHC class I to inhibit NK-cell functions. Results from studies in vitro are not uniform, but in general they support the proposal that the class I homologues engage inhibitory receptors from NK cells and other cell types that normally interact with cellular class I. Consistent with this, in vivo studies of murine cytomegalovirus indicate that the class I homologue is required for efficient evasion of NK-cell-mediated clearance. Recently a second murine cytomegalovirus protein, a C-C chemokine homologue, has been implicated as promoting evasion of NK and T-cell-mediated clearance in vivo.

The murine cytomegalovirus chemokine homolog, m131/129, is a determinant of viral pathogenicity

Chemokines are important mediators of the early inflammatory response to infection and modify a wide range of host immune responses. Functional homologs of cellular chemokines have been identified in a number of herpesviruses, suggesting that the subversion of the host chemokine response contributes to the pathogenesis of these viruses. Transcriptional and reverse transcription-PCR analyses demonstrated that the murine cytomegalovirus (MCMV) chemokine homolog, m131, was spliced at the 3' end to the adjacent downstream open reading frame, m129, resulting in a predicted product of 31 kDa, which is significantly larger than most known chemokines. The in vivo impact of m131/129 was investigated by comparing the replication of MCMV mutants having m131/129 deleted (Delta m131/129) with that of wild-type (wt) MCMV. Our studies demonstrate that both wt and Delta m131/129 viruses replicated to equivalent levels during the first 2 to 3 days following in vivo infection. However, histological studies demonstrated that the early inflammatory response elicited by Delta m131/129 was reduced compared with that of wt MCMV. Furthermore, the Delta m131/129 mutants failed to establish a high-titer infection in the salivary glands, These results suggest that m131/129 possesses proinflammatory properties in vivo and is important for the dissemination of MCMV to or infection of the salivary gland. Notably, the Delta m131/129 mutants were cleared more rapidly from the spleen and liver during acute infection compared with wt MCMV. The accelerated clearance of the mutants was dependent on NK cells and cells of the CD4(+) CD8(+) phenotype. These data suggest that m131/129 may also contribute to virus mechanisms of immune system evasion during early infection, possibly through the interference of NK cells and T cells.

Comparison of acetylcholinesterase genes from cattle ticks

We describe the isolation and characterisation of two putatively new acetylcholinesterase genes from the African cattle ticks Boophilus decoloratus and Rhipicephalus appendiculatus. The nucleotide sequences of these genes had 93% homology to each other and 95% and 91% identity, respectively, to the acetylcholinesterase gene from an Australian strain of another cattle tick, Boophilus microplus. Translation of the nucleotide sequences revealed putative amino acids that are essential for acetylcholinesterase activity: the active site serine, and the histidine and glutamate residues that associate with this serine to form the catalytic triad. All known acetylcholinesterases have three sets of cysteines that form disulfide bonds; however, the acetylcholinesterase genes of these three species of ticks encode only two sets of cysteines. Acetylcholinesterases of B. microplus from South Africa, Zimbabwe, Kenya and Mexico had 98-99% identity with acetylcholinesterase from B. microplus from Australia, whereas acetylcholinesterase from B. microplus from Indonesia was identical to that from Australia. Preliminary phylogenetic analyses surprisingly indicate that the acetylcholinesterases of ticks are closer phylogenetically to acetylcholinesterases of vertebrates than they are to those of other arthropods. (C) 1999 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved.

Murine cytomegalovirus homologues of cellular immunomodulatory genes

The study of 'molecular mimicry' or 'genetic piracy', with respect to the utilisation of cellular genes captured and modified during the course of virus evolution, has been an area of increasing research with the expansion in virus genome sequencing. Examples of cellular immunomodulatory genes which have been captured from hosts have been identified in a number of viruses. This review concentrates upon studies of murine cytomegalovirus (MCMV), investigating the functions of viral genes homologous to G protein-coupled receptors, MHC class I and chemokines, The study of recombinant MCMV engineered with specific disruptions of these genes has revealed their significance during virus replication and dissemination within the host, In the case of the latter two classes of genes, evidence suggests they interfere with cellular immune responses, although the detailed mechanisms underlying this interference have yet to be delineated. Copyright (C) 2000 S. Karger AG, Basel.

Apiomorpha gullanae sp n., an unusual new species of gall-inducing scale insect (Hemiptera : Eriococcidae)

An unusual new species of the gall-inducing scale insect genus Apiomorpha Rubsaamen is described from Queensland. The adult female, its gall, and the first-instar nymph (crawler) are illustrated, and relationships of the new species are estimated using mitochondrial COII data. Adult females induce cigar-shaped galls on leaves of several eucalypts in section Adnataria of subgenus Symphyomyrtus. The bilobed anal lobes of the adult female differ from those of all other Apiomorpha species (single lobe) and the first-instar nymph possesses features, such as broad frontal tubercles and dorsal stripes, that are not present in crawlers of other Apiomorpha species. However, DNA sequence data confirm that the new species falls within Apiomorpha, rather than representing a sister group, and indicate that the new species is not closely related to the A. pharetrata (Schrader) species-group, the only other group within Apiomorpha that induces cigar-shaped galls on leaves. The systematic affiliations of A. gullanae sp. n. are currently not known. Females only are known and there is some indication that reproduction in the new taxon is parthenogenetic. This represents the first putative case of parthenogenesis in Apiomorpha.

The gall-inducing habit has evolved multiple times among the eriococcid scale insects (Sternorrhyncha : Coccoidea : Eriococcidae)

The habit of inducing plant galls has evolved multiple times among insects but most species diversity occurs in only a few groups, such as gall midges and gall wasps. This phylogenetic clustering may reflect adaptive radiations in insect groups in which the trait has evolved. Alternatively, multiple independent origins of galling may suggest a selective advantage to the habit. We use DNA sequence data to examine the origins of galling among the most speciose group of gall-inducing scale insects, the eriococcids. We determine that the galling habit has evolved multiple times, including four times in Australian taxa, suggesting that there has been a selective advantage to galling in Australia. Additionally, although most gall-inducing eriococcid species occur on Myrtaceae, we found that lineages feeding on Myrtaceae are no more likely to have evolved the galling habit than those feeding on other plant groups. However, most gall-inducing species-richness is clustered in only two clades (Apiomorpha and Lachnodius + Opisthoscelis), all of which occur exclusively on Eucalyptus s.s. The Eriococcidae and the large genus Eriococcus were determined to be non-monophyletic and each will require revision. (C) 2004 The Linnean Society of London.

Mitochondrial genome data alone are not enough to unambiguously resolve the relationships of Entognatha, Insecta and Crustacea sensu lato (Arthropoda)

An analysis of the relationships of the major arthropod groups Was undertaken using mitochondrial genome data to examine the hypotheses that Hexapoda is polyphyletic and that Collembola is more closely related to branchiopod crustaceans than insects. We sought to examine the sensitivity of this relationship to outgroup choice, data treatment. gene choice and optimality criteria used in the phylogenetic analysis of mitochondrial genome data. Additionally we sequenced the mitochondrial genome of ail archaeognathan, Nesomachilis australica. to improve taxon selection in the apterygote insects, a group poorly represented in previous mitochondrial phylogenies. The sister group of the Collembola was rarely resolved in our analyses with a significant level of support. The use of different outgroups (myriapods, nematodes, or annelids + mollusks) resulted in many different placements of Collembola. The way in which the dataset was coded for analysis (DNA, DNA with the exclusion of third codon position and as amino acids) also had marked affects on tree topology. We found that nodal Support was spread evenly throughout the 13 mitochondrial genes and the exclusion of genes resulted in significantly less resolution in the inferred trees. Optimality criteria had a much lesser effect on topology than the preceding factors; parsimony and Bayesian trees for a given data set and treatment were quite similar. We therefore conclude that the relationships of the extant arthropod groups as inferred by mitochondrial genomes are highly vulnerable to outgroup choice, data treatment and gene choice, and no consistent alternative hypothesis of Collembola's relationships is supported. Pending the resolution of these identified problems with the application of mitogenomic data to basal arthropod relationships, it is difficult to justify the rejection of hexapod monophyly, which is well supported on morphological grounds. (c) The Willi Hennig Society 2004.

Generic delimitation and phylogenetic uncertainty: An example from a group that has undergone an explosive radiation

Phylogenetic trees can provide a stable basis for a higher-level classification of organisms that reflects evolutionary relationships. However, some lineages have a complex evolutionary history that involves explosive radiation or hybridisation. Such histories have become increasingly apparent with the use of DNA sequence data for phylogeny estimation and explain, in part, past difficulties in producing stable morphology-based classifications for some groups. We illustrate this situation by using the example of tribe Mirbelieae (Fabaceae), whose generic classification has been fraught for decades. In particular, we discuss a recent proposal to combine 19 of the 25 Mirbelieae genera into a single genus, Pultenaea sens. lat., and how we might find stable and consistent ways to squeeze something as complex as life into little boxes for our own convenience. © CSIRO.

Report of the equine herpesvirus-1 Havermeyer Workshop, San Gimignano, Tuscany, June 2004

Amongst the infectious diseases that threaten equine health, herpesviral infections remain a world wide cause of serious morbidity and mortality. Equine herpesvirus-1 infection is the most important pathogen, causing an array of disorders including epidemic respiratory disease abortion, neonatal foal death, myeloencephalopathy and chorioretinopathy. Despite intense scientific investigation, extensive use of vaccination, and established codes of practice for control of disease outbreaks, infection and disease remain common. While equine herpesvirus-1 infection remains a daunting challenge for immunoprophylaxis, many critical advances in equine immunology have resulted in studies of this virus, particularly related to MHC-restricted cytotoxicity in the horse. A workshop was convened in San Gimignano, Tuscany, Italy in June 2004, to bring together clinical and basic researchers in the field of equine herpesvirus-1 study to discuss the latest advances and future prospects for improving our under-standing of these diseases, and equine immunity to herpesviral infection. This report highlights the new information that was the focus of this workshop, and is intended to summarize this material and identify the critical questions in the field. (c) 2006 Elsevier B.V. All rights reserved.

Identification and characterization of a G protein-coupled receptor homolog encoded by murine cytomegalovirus

This report describes the identification of a murine cytomegalovirus (MCMV) G protein-coupled receptor (GCR) homolog. This open reading frame (M33) is most closely related to, and collinear with, human cytomegalovirus UL33, and homologs are also present in human herpesvirus 6 and 7 (U12 for both viruses). Conserved counterparts in the sequenced alpha- or gammaherpesviruses have not been identified to date, suggesting that these genes encode proteins which are important for the biological characteristics of betaherpesviruses. We have detected transcripts for both UL33 and M33 as early as 3 or 4 h postinfection, and these reappear at late times. In addition, we have identified N-terminal splicing for both the UL33 and M33 RNA transcripts. For both open reading frames, splicing results in the introduction of amino acids which are highly conserved among known GCRs. To characterise the function of the M33 in the natural host, two independent MCMV recombinant viruses were prepared, each of which possesses an M33 open reading frame which has been disrupted with the beta-galactosidase gene. While the recombinant M33 null viruses showed no phenotypic differences in replication from wild-type MCMV in primary mouse embryo fibroblasts in vitro, they showed severely restricted growth in the salivary glands of infected mice. These data suggest that M33 plays an important role in vivo, in particular in the dissemination to or replication in the salivary gland, and provide the first evidence for the function of a viral GCR homolog in vivo.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Lipopolysaccharide biosynthesis genes in koala type I Chlamydia: Cloning and characterization

We showed in 1988 that there are two strains of Chlamydia psittaci which infect the koala (Phascolarctos cinereus). In order to further investigate the role of these chlamydial strains in pathogenesis, we have attempted to identify genes of koala type I strain chlamydial which are involved in the immunogenic response, Transformation of Escherichia coli with a plasmid containing a 6.3-kb fragment (pKOC-10) of C. psittaci DNA caused the appearance of a specific chlamydial lipopolysaccharide (LPS) epitope on the host strain. The smallest DNA fragment capable of inducing the expression of chlamydial LPS was an Xbal fragment, 2.4 kb in size (pKOC-5). DNA sequence analysis of the complete fragment revealed regions of high identity, at the amino acid level, to the gseA genes of C. pneomoniae, C. psittaci 6BC and C. trachomatis, and the kdtA gene of E. coli which code for transferases catalysing the addition of 3-deoxy-D-manno-octulosonic acid (Kdo) residues to lipid A. Two open reading frames (ORFs) of 1,314 and 501 nucleotides in size, within the 2.4-kb fragment, were evident, and mRNA species corresponding to these ORFs were detected by Northern analysis. Both ORF1 and ORF2 are required for the appearance of chlamydia-specific LPS on the surface of recombinant E. coli.