31 resultados para Chromosomes.


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Lentil is a self-pollinating diploid (2n = 14 chromosomes) annual cool season legume crop that is produced throughout the world and is highly valued as a high protein food. Several abiotic stresses are important to lentil yields world wide and include drought, heat, salt susceptibility and iron deficiency. The biotic stresses are numerous and include: susceptibility to Ascochyta blight, caused by Ascochyta lentis; Anthracnose, caused by Colletotrichum truncatum; Fusarium wilt, caused by Fusarium oxysporum; Sclerotinia white mold, caused by Sclerotinia sclerotiorum; rust, caused by Uromyces fabae; and numerous aphid transmitted viruses. Lentil is also highly susceptible to several species of Orabanche prevalent in the Mediterranean region, for which there does not appear to be much resistance in the germplasm. Plant breeders and geneticists have addressed these stresses by identifying resistant/tolerant germplasm, determining the genetics involved and the genetic map positions of the resistant genes. To this end progress has been made in mapping the lentil genome and several genetic maps are available that eventually will lead to the development of a consensus map for lentil. Marker density has been limited in the published genetic maps and there is a distinct lack of co-dominant markers that would facilitate comparisons of the available genetic maps and efficient identification of markers closely linked to genes of interest. Molecular breeding of lentil for disease resistance genes using marker assisted selection, particularly for resistance to Ascochyta blight and Anthracnose, is underway in Australia and Canada and promising results have been obtained. Comparative genomics and synteny analyses with closely related legumes promises to further advance the knowledge of the lentil genome and provide lentil breeders with additional genes and selectable markers for use in marker assisted selection. Genomic tools such as macro and micro arrays, reverse genetics and genetic transformation are emerging technologies that may eventually be available for use in lentil crop improvement.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Familial Mediterranean fever (FMF) is a recessively inherited disorder characterized by dramatic episodes of fever and serosal inflammation. This report describes the cloning of the gene likely to cause FMF from a 115-kb candidate interval on chromosome 16p. Three different missense mutations were identified in affected individuals, but not in normals. Haplotype and mutational analyses disclosed ancestral relationships among carrier chromosomes in populations that have been separated for centuries. The novel gene encodes a 3.7-kb transcript that is almost exclusively expressed in granulocytes. The predicted protein, pyrin, is a member of a family of nuclear factors homologous to the Ro52 autoantigen. The cloning of the FMF gene promises to shed light on the regulation of acute inflammatory responses.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Familial Mediterranean fever (FMF) is a recessive disorder of inflammation caused by mutations in a gene (designated MEFV) on chromosome 16p13.3, We have recently constructed a 1-Mb cosmid contig that includes the FMF critical region. Here we show genotype data for 12 markers from our physical map, including 5 newly identified microsatellites, in FMF families. Intrafamilial recombinations placed MEFV in the similar to 285 kb between D16S468/D16S3070 and D16S3376. We observed significant linkage disequilibrium in the North African Jewish population, and historical recombinants in the founder haplotype placed MEFV between D16S3082 and D16S3373 (similar to 200 kb). In smaller panels of Iraqi Jewish, Arab, and Armenian families, there were significant allelic associations only for D16S3370 and D16S2617 among the Armenians. A sizable minority of Iraqi Jewish and Armenian carrier chromosomes appeared to be derived from the North African Jewish ancestral haplotype. We observed a unique FMF haplotype common to Iraqi Jews, Arabs, and Armenians and two other haplotypes restricted to either the Iraqi Jewish or the Armenian population. These data support the view that a few major mutations account for a large percentage of the cases of FMF and suggest that same of these mutations arose before the affected Middle Eastern populations diverged from one another. (C) 1997 Academic Press.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Hyperplastic polyposis is a loosely defined syndrome initially thought not to confer a clinically important predisposition to colorectal cancer. The aim of the current study was to examine the clinical, histologic, and molecular features of a prospective series of cases meeting a strict definition of the condition. Twelve patients were identified, seven of whom had developed colorectal cancer. Most polyps were hyperplastic, but 11 patients also had polyps containing dysplasia as either serrated adenomas. mixed polyps, or traditional adenomas. The mean percentage of dysplastic polyps in patients with cancer was 35%, and in patients without cancer, 11%(p < 0.05). Microsatellite instability (MSI) was present in 3 of 47 hyperplastic polyps and two of right serrated adenomas. Kras was mutated in 8 of 47 hyperplastic polyps and two of eight serrated adenomas. No polyps showed loss of heterozygosity of chromosomes 5q, 1p, or 18q. Two of seven cancers showed a high level of MSI. It is concluded that hyperplastic polyposis is associated with a high risk of colorectal cancer. Hyperplastic polyps are the dominant type of polyp, but most cases have some dysplastic epithelium. A higher proportion of dysplastic polyps is associated with increased cancer risk. Clonal generic changes are observed in some hyperplastic polyps and serrated adenomas.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Prader-Willi syndrome (PWS) was originally described less than 50 y ago,1 although reference to children with characteristics of the syndrome are to be found in other literature previous to this.2 Until relatively recently the diagnosis was made upon the clinical features as outlined by Holm,3 which include severe muscular hypotonia in the neonatal period leading to feeding difficulties and undernutrition, hypogonadism and later hyperphagia and obesity. Latterly the syndrome has been identified as being associated with an interstitial deletion of the q11-13 region on chromosome 15.4 In the majority of cases the deletion is in the paternally derived chromosome. In the remainder of cases there seems to be a failure to inherit the entire paternal chromosome and as a consequence both the chromosomes inherited are maternal, thus leading to maternal disomy.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The male hypermethylated (MHM) region, located near the middle of the short arm of the Z chromosome of chickens, consists of approximately 210 tandem repeats of a BamHI 2.2-kb sequence unit. Cytosines of the CpG dinucleotides of this region are extensively methylated on the two Z chromosomes in the male but much less methylated on the single Z chromosome in the female. The state of methylation of the MHM region is established after fertilization by about the 1-day embryonic stage. The MHM region is transcribed only in the female from the particular strand into heterogeneous, high molecular-mass, non-coding RNA, which is accumulated at the site of transcription, adjacent to the DMRT1 locus, in the nucleus. The transcriptional silence of the MHM region in the male is most likely caused by the CpG methylation, since treatment of the male embryonic fibroblasts with 5-azacytidine results in hypo-methylation and active transcription of this region. In ZZW triploid chickens, MHM regions are hypomethylated and transcribed on the two Z chromosomes, whereas MHM regions are hypermethylated and transcriptionally inactive on the three Z chromosomes in ZZZ triploid chickens, suggesting a possible role of the W chromosome on the state of the MHM region.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Single cell genetic analysis is generally performed using PCR and FISH. Until recently, FISH has been the method of choice. FISH however is expensive, has significant misdiagnosis rates, can result in interpretation difficulties and is labour intensive making it unsuitable for high throughput processing. Recently fluorescent PCR reliability has increased to levels at or surpassing FISH whilst maintaining low cost. However, PCR accuracy has been a concern due to allelic dropout. Multiplex PCR can now increase accuracy by using multiple markers for each chromosome to firstly provide diagnosis if markers fail and,or secondly confirm diagnosis. We compare a variety of diagnostic methods and demonstrate for the first time a multiplex PCR system providing simultaneous diagnosis and confirmation of the major aneuploidy chromosomes (21, 18, 13) and sex as well as DNA fingerprint in single cells. We also discuss the implications of using PCR for aneuploidy screening in preimplantation genetic diagnosis. (C) 2001 Elsevier Science Ireland Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Paget disease of bone (PDB) is characterized by increased osteoclast activity and localized abnormal bone remodeling. PDB has a significant genetic component, with evidence of linkage to chromosomes 6p21.3 (PDB1) and 18q21-22 (PDB2) in some pedigrees. There is evidence of genetic heterogeneity, with other pedigrees showing negative linkage to these regions. TNFRSF11A, a gene that is essential for osteoclast formation and that encodes receptor activator of nuclear factor-kappa B (RANK), has been mapped to the PDB2 region. TNFRSF11A mutations that segregate in pedigrees with either familial expansile osteolysis or familial PDB have been identified; however, linkage studies and mutation screening have excluded the involvement of RANK in the majority of patients with PDB. We have excluded linkage, both to PDB1 and to PDB2, in a large multigenerational pedigree with multiple family members affected by PDB. We have conducted a genomewide scan of this pedigree, followed by fine mapping and multipoint analysis in regions of interest. The peak two-point LOD scores from the genomewide scan were 2.75, at D7S507, and 1.76, at D18S70. Multipoint and haplotype analysis of markers flanking D7S507 did not support linkage to this region. Haplotype analysis of markers flanking D18S70 demonstrated a haplotype segregating with PDB in a large subpedigree. This subpedigree had a significantly lower age at diagnosis than the rest of the pedigree (51.2 +/- 8.5 vs. 64.2 +/- 9.7 years; P = .0012). Linkage analysis of this subpedigree demonstrated a peak two-point LOD score of 4.23, at marker D18S1390 (theta = 0), and a peak multipoint LOD score of 4.71, at marker D18S70. Our data are consistent with genetic heterogeneity within the pedigree and indicate that 18q23 harbors a novel susceptibility gene for PDB.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

High levels of inheritable resistance to phosphine in Rhyzopertha dominica have recently, been detected in Australia and hi art effort to isolate the genes responsible For resistance we have used random amplified DNA fingerprinting (RAF) to produce a genetic linkage map of R. dominica. The map consists of 94 dominant DNA markers with art average distance between markers of 4.6 cM and defines nine linkage groups with a total recombination distance of 390.1 cM. We have identified two loci that are responsible for high-level resistance. One provides similar to50x resistance to phosphine while the other provides 12.5x resistance and in combination, the two genes act synergistically to provide a resistance level 250 x greater than that of fully susceptible beetles. The haploid genome size has been determined to be 4.76 x 10(8) bp, resulting in an average physical distance of 1.2 Mbp per map unit. No recombination has been observed between either of the two resistance loci and their adjacent DNA markers in a population of 44 fully resistant F-5 individuals, which indicates that the genes are likely to reside within 0.91 cM (1.1 Mbp) of the DNA markers.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The choice of genotyping families vs unrelated individuals is a critical factor in any large-scale linkage disequilibrium (LD) study. The use of unrelated individuals for such studies is promising, but in contrast to family designs, unrelated samples do not facilitate detection of genotyping errors, which have been shown to be of great importance for LD and linkage studies and may be even more important in genotyping collaborations across laboratories. Here we employ some of the most commonly-used analysis methods to examine the relative accuracy of haplotype estimation using families vs unrelateds in the presence of genotyping error. The results suggest that even slight amounts of genotyping error can significantly decrease haplotype frequency and reconstruction accuracy, that the ability to detect such errors in large families is essential when the number/complexity of haplotypes is high (low LD/common alleles). In contrast, in situations of low haplotype complexity (high LD and/or many rare alleles) unrelated individuals offer such a high degree of accuracy that there is little reason for less efficient family designs. Moreover, parent-child trios, which comprise the most popular family design and the most efficient in terms of the number of founder chromosomes per genotype but which contain little information for error detection, offer little or no gain over unrelated samples in nearly all cases, and thus do not seem a useful sampling compromise between unrelated individuals and large families. The implications of these results are discussed in the context of large-scale LD mapping projects such as the proposed genome-wide haplotype map.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We describe for the first time the application of fast neutron mutagenesis to the genetic dissection of root nodulation in legumes. We demonstrate the utility of chromosomal deletion mutations through production of a soybean supernodulation mutant FN37 that lacks the internal autoregulation of nodulation mechanism. After inoculation with microsymbiont Bradyrhizobium japonicum, FN37 forms at least 10 times more nodules than the wild type G. soja parent and has a phenotype identical to that of chemically induced allelic mutants nts382 and nts1007 (NTS-1 locus). Reciprocal grafting of shoots and roots confirmed systemic shoot control of the FN37 nodulation phenotype. RFLP/PCR marker pUTG132a and AFLP marker UQC-IS1 which are tightly linked to NTS-1 allowed the isolation of BAC contigs delineating both ends of the deletion. The genetic/physical distance ratio in the NTS-1 region is 279 kb/cM. The deletion is estimated to be about 460 kb based on the absence of markers and bacterial artificial chromosomes (BAC) ends as well as genetic and physical mapping. Deletion break points were determined physically and placed within flanking BAC contigs.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A new RTE-like, non-long terminal repeat retrotransposon, termed SjR2, from the human blood fluke, Schistosoma japonicum, is described. SjR2 is similar to3.9 kb in length and is constituted of a single open reading frame encoding a polyprotein with apurinic/apyrimidinic endonuclease and reverse transcriptase domains. The open reading frame is bounded by 5'- and 3'-terininal untranslated regions and, at its 3-terminus, SjR2 bears a short (TGAC)(3) repeat. Phylogenetic analyses based on conserved domains of reverse transcriptase or endonuclease revealed that SjR2 belonged to the RTE clade of non-long terminal repeat retrotransposons. Further, SjR2 was homologous, but probably not orthologous, to SR2 front the African blood fluke, Schistosoma mansoni; this RTE-like family of non-long terminal repeat retrotransposons appears to have arisen before the divergence of the extant schistosome species. Hybridisation analyses indicated that similar to 10,000 copies of SjR2 were dispersed throughout the S. japonicum chromosomes, accounting for up to 14% of the nuclear genome. Messenger RNAs encoding the reverse transcriptase and endonuclease domains of SjR2 were detected in several developmental stages of the schistosome, indicating that the retrotransposon was actively replicating within the genome of the parasite. Exploration of the coding and non-coding regions of SjR2 revealed two notable characteristics. First, the recombinant reverse transcriptase domain of SjR2 expressed in insect cells primed reverse transcription of SjR2 mRNA in vitro. By contrast, recombinant SjR2-endonuclease did not appear to cleave schistosome or plasmid DNA. Second, the 5'-untranslated region of SjR2 was >80% identical to the 3-untranslated region of a schistosome heat shock protein-70 gene (hsp-70) in the antisense orientation, indicating that SjR2-like elements were probably inserted into the non-coding regions of ancestral S. japonicum HSP-70, probably after the species diverged from S. mansoni. (C) 2002 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador: